Incidental Mutation 'R9581:Aox1'
ID 722517
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Name aldehyde oxidase 1
Synonyms Aox-1, retinal oxidase, Aox-2, Aox2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58069090-58145572 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 58370055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366] [ENSMUST00000114366]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000114366
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114366
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dip2b C A 15: 100,079,255 (GRCm39) N822K probably damaging Het
Dnah12 C T 14: 26,491,985 (GRCm39) T1140I probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprf T C 4: 118,092,257 (GRCm39) D571G probably benign Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Sec16a C T 2: 26,328,647 (GRCm39) V142I Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Strc A G 2: 121,207,928 (GRCm39) V481A probably damaging Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58,098,203 (GRCm39) missense probably damaging 1.00
IGL01014:Aox1 APN 1 58,361,960 (GRCm39) missense possibly damaging 0.73
IGL01077:Aox1 APN 1 58,096,569 (GRCm39) splice site probably benign
IGL01288:Aox1 APN 1 58,333,566 (GRCm39) missense probably damaging 0.99
IGL01335:Aox1 APN 1 58,121,312 (GRCm39) nonsense probably null
IGL01383:Aox1 APN 1 58,333,464 (GRCm39) missense probably benign 0.09
IGL01410:Aox1 APN 1 58,145,184 (GRCm39) splice site probably null
IGL01684:Aox1 APN 1 58,116,740 (GRCm39) splice site probably null
IGL01727:Aox1 APN 1 58,112,387 (GRCm39) nonsense probably null
IGL01734:Aox1 APN 1 58,393,469 (GRCm39) missense possibly damaging 0.95
IGL01793:Aox1 APN 1 58,375,783 (GRCm39) missense possibly damaging 0.79
IGL01805:Aox1 APN 1 58,120,672 (GRCm39) missense possibly damaging 0.94
IGL01834:Aox1 APN 1 58,348,183 (GRCm39) missense possibly damaging 0.90
IGL01924:Aox1 APN 1 58,326,902 (GRCm39) missense possibly damaging 0.90
IGL01996:Aox1 APN 1 58,121,225 (GRCm39) missense probably benign 0.11
IGL02060:Aox1 APN 1 58,137,114 (GRCm39) missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58,104,499 (GRCm39) missense probably benign 0.00
IGL02591:Aox1 APN 1 58,398,158 (GRCm39) nonsense probably null
IGL02645:Aox1 APN 1 58,373,883 (GRCm39) missense probably damaging 1.00
IGL02710:Aox1 APN 1 58,373,928 (GRCm39) critical splice donor site probably null
IGL02801:Aox1 APN 1 58,393,336 (GRCm39) missense probably damaging 1.00
IGL02839:Aox1 APN 1 58,107,943 (GRCm39) missense probably benign 0.05
IGL02975:Aox1 APN 1 58,107,550 (GRCm39) missense probably damaging 1.00
IGL02988:Aox1 APN 1 58,376,509 (GRCm39) missense probably benign
IGL03062:Aox1 APN 1 58,117,624 (GRCm39) missense probably benign 0.01
IGL03104:Aox1 APN 1 58,321,918 (GRCm39) missense probably benign
IGL03121:Aox1 APN 1 58,398,113 (GRCm39) missense probably damaging 1.00
IGL03191:Aox1 APN 1 58,398,228 (GRCm39) missense probably null 0.98
IGL03236:Aox1 APN 1 58,349,156 (GRCm39) nonsense probably null
IGL03286:Aox1 APN 1 58,088,543 (GRCm39) missense probably benign 0.19
IGL03335:Aox1 APN 1 58,115,319 (GRCm39) missense probably damaging 0.98
IGL03395:Aox1 APN 1 58,107,884 (GRCm39) splice site probably benign
IGL03409:Aox1 APN 1 58,393,588 (GRCm39) missense possibly damaging 0.91
PIT4362001:Aox1 UTSW 1 58,321,839 (GRCm39) missense probably damaging 1.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0048:Aox1 UTSW 1 58,112,371 (GRCm39) missense probably damaging 0.98
R0144:Aox1 UTSW 1 58,109,233 (GRCm39) missense probably benign 0.00
R0207:Aox1 UTSW 1 58,144,173 (GRCm39) missense possibly damaging 0.82
R0267:Aox1 UTSW 1 58,378,605 (GRCm39) splice site probably benign
R0357:Aox1 UTSW 1 58,131,675 (GRCm39) missense probably damaging 1.00
R0383:Aox1 UTSW 1 58,100,400 (GRCm39) missense probably benign 0.00
R0388:Aox1 UTSW 1 58,393,565 (GRCm39) missense probably damaging 1.00
R0399:Aox1 UTSW 1 58,108,008 (GRCm39) splice site probably null
R0409:Aox1 UTSW 1 58,375,783 (GRCm39) missense possibly damaging 0.90
R0465:Aox1 UTSW 1 58,101,366 (GRCm39) missense probably damaging 1.00
R0480:Aox1 UTSW 1 58,082,810 (GRCm39) splice site probably benign
R0547:Aox1 UTSW 1 58,349,201 (GRCm39) missense probably damaging 0.96
R0630:Aox1 UTSW 1 58,376,480 (GRCm39) splice site probably benign
R0726:Aox1 UTSW 1 58,373,941 (GRCm39) splice site probably benign
R0734:Aox1 UTSW 1 58,344,500 (GRCm39) missense probably benign 0.22
R0831:Aox1 UTSW 1 58,378,842 (GRCm39) missense probably benign 0.28
R0961:Aox1 UTSW 1 58,349,230 (GRCm39) missense probably benign 0.00
R1005:Aox1 UTSW 1 58,104,511 (GRCm39) missense probably benign 0.00
R1404:Aox1 UTSW 1 58,385,371 (GRCm39) splice site probably benign
R1507:Aox1 UTSW 1 58,143,610 (GRCm39) missense probably benign 0.01
R1512:Aox1 UTSW 1 58,346,510 (GRCm39) missense probably benign 0.00
R1573:Aox1 UTSW 1 58,348,186 (GRCm39) missense probably benign 0.00
R1592:Aox1 UTSW 1 58,339,853 (GRCm39) missense probably benign 0.00
R1597:Aox1 UTSW 1 58,086,326 (GRCm39) missense probably damaging 1.00
R1693:Aox1 UTSW 1 58,124,701 (GRCm39) missense probably damaging 1.00
R1709:Aox1 UTSW 1 58,116,633 (GRCm39) missense probably benign
R1747:Aox1 UTSW 1 58,378,751 (GRCm39) missense probably benign 0.01
R1768:Aox1 UTSW 1 58,393,354 (GRCm39) missense probably benign 0.00
R1809:Aox1 UTSW 1 58,333,484 (GRCm39) missense probably benign
R1823:Aox1 UTSW 1 58,351,518 (GRCm39) missense probably benign 0.02
R1834:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1835:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1836:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1869:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1870:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1898:Aox1 UTSW 1 58,117,601 (GRCm39) missense probably damaging 1.00
R1908:Aox1 UTSW 1 58,141,783 (GRCm39) missense probably damaging 1.00
R2002:Aox1 UTSW 1 58,086,300 (GRCm39) missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2065:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2219:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2220:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2265:Aox1 UTSW 1 58,120,679 (GRCm39) missense probably damaging 0.99
R2508:Aox1 UTSW 1 58,382,832 (GRCm39) missense probably benign 0.38
R2942:Aox1 UTSW 1 58,376,540 (GRCm39) missense probably benign 0.03
R2967:Aox1 UTSW 1 58,361,993 (GRCm39) missense probably damaging 0.96
R3082:Aox1 UTSW 1 58,322,759 (GRCm39) splice site probably benign
R3161:Aox1 UTSW 1 58,343,597 (GRCm39) missense possibly damaging 0.91
R3408:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R3713:Aox1 UTSW 1 58,095,374 (GRCm39) missense probably benign 0.01
R3778:Aox1 UTSW 1 58,092,862 (GRCm39) missense possibly damaging 0.89
R3803:Aox1 UTSW 1 58,329,058 (GRCm39) splice site probably null
R3894:Aox1 UTSW 1 58,373,837 (GRCm39) critical splice acceptor site probably null
R4198:Aox1 UTSW 1 58,124,766 (GRCm39) missense probably benign
R4214:Aox1 UTSW 1 58,346,603 (GRCm39) critical splice donor site probably null
R4249:Aox1 UTSW 1 58,338,978 (GRCm39) missense probably benign 0.01
R4296:Aox1 UTSW 1 58,096,559 (GRCm39) splice site probably null
R4562:Aox1 UTSW 1 58,098,215 (GRCm39) missense probably damaging 0.99
R4666:Aox1 UTSW 1 58,343,756 (GRCm39) nonsense probably null
R4668:Aox1 UTSW 1 58,373,853 (GRCm39) missense possibly damaging 0.63
R4703:Aox1 UTSW 1 58,398,116 (GRCm39) missense possibly damaging 0.78
R4758:Aox1 UTSW 1 58,371,741 (GRCm39) missense probably benign 0.00
R4858:Aox1 UTSW 1 58,143,640 (GRCm39) missense probably benign
R4862:Aox1 UTSW 1 58,134,316 (GRCm39) missense probably damaging 0.98
R4890:Aox1 UTSW 1 58,373,862 (GRCm39) missense probably benign 0.11
R4900:Aox1 UTSW 1 58,344,544 (GRCm39) missense probably benign
R4924:Aox1 UTSW 1 58,344,503 (GRCm39) missense probably damaging 1.00
R4970:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5048:Aox1 UTSW 1 58,098,641 (GRCm39) splice site probably benign
R5112:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5127:Aox1 UTSW 1 58,069,185 (GRCm39) missense probably benign 0.00
R5139:Aox1 UTSW 1 58,100,456 (GRCm39) missense probably benign 0.03
R5157:Aox1 UTSW 1 58,109,222 (GRCm39) missense probably damaging 1.00
R5168:Aox1 UTSW 1 58,088,561 (GRCm39) missense probably damaging 1.00
R5186:Aox1 UTSW 1 58,107,529 (GRCm39) missense probably damaging 1.00
R5235:Aox1 UTSW 1 58,096,714 (GRCm39) missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58,131,717 (GRCm39) missense probably damaging 0.99
R5466:Aox1 UTSW 1 58,080,619 (GRCm39) missense probably damaging 1.00
R5540:Aox1 UTSW 1 58,143,569 (GRCm39) missense probably benign 0.03
R5615:Aox1 UTSW 1 58,136,125 (GRCm39) missense probably benign
R5652:Aox1 UTSW 1 58,134,356 (GRCm39) missense probably damaging 1.00
R5920:Aox1 UTSW 1 58,088,631 (GRCm39) missense probably damaging 1.00
R5987:Aox1 UTSW 1 58,346,518 (GRCm39) missense probably benign 0.00
R6008:Aox1 UTSW 1 58,116,672 (GRCm39) missense probably damaging 1.00
R6073:Aox1 UTSW 1 58,143,668 (GRCm39) critical splice donor site probably null
R6215:Aox1 UTSW 1 58,124,620 (GRCm39) missense probably benign
R6239:Aox1 UTSW 1 58,344,550 (GRCm39) critical splice donor site probably null
R6273:Aox1 UTSW 1 58,378,831 (GRCm39) missense probably benign 0.00
R6291:Aox1 UTSW 1 58,369,965 (GRCm39) missense probably damaging 0.98
R6334:Aox1 UTSW 1 58,346,566 (GRCm39) nonsense probably null
R6403:Aox1 UTSW 1 58,107,594 (GRCm39) missense probably damaging 1.00
R6440:Aox1 UTSW 1 58,133,631 (GRCm39) missense probably damaging 1.00
R6601:Aox1 UTSW 1 58,102,665 (GRCm39) missense probably damaging 1.00
R6608:Aox1 UTSW 1 58,096,705 (GRCm39) missense probably benign 0.40
R6752:Aox1 UTSW 1 58,086,398 (GRCm39) missense probably benign 0.00
R6764:Aox1 UTSW 1 58,389,441 (GRCm39) missense probably damaging 0.97
R6766:Aox1 UTSW 1 58,388,227 (GRCm39) missense possibly damaging 0.95
R6789:Aox1 UTSW 1 58,343,644 (GRCm39) missense probably benign 0.01
R6804:Aox1 UTSW 1 58,343,757 (GRCm39) missense probably benign 0.04
R6989:Aox1 UTSW 1 58,124,611 (GRCm39) missense probably damaging 1.00
R7007:Aox1 UTSW 1 58,370,051 (GRCm39) missense probably damaging 1.00
R7015:Aox1 UTSW 1 58,321,917 (GRCm39) missense probably benign 0.00
R7042:Aox1 UTSW 1 58,141,759 (GRCm39) missense probably damaging 0.99
R7055:Aox1 UTSW 1 58,338,927 (GRCm39) missense probably benign 0.08
R7089:Aox1 UTSW 1 58,375,808 (GRCm39) missense probably benign 0.01
R7157:Aox1 UTSW 1 58,322,651 (GRCm39) missense probably benign 0.00
R7303:Aox1 UTSW 1 58,373,924 (GRCm39) nonsense probably null
R7426:Aox1 UTSW 1 58,329,142 (GRCm39) nonsense probably null
R7442:Aox1 UTSW 1 58,121,172 (GRCm39) missense probably damaging 1.00
R7506:Aox1 UTSW 1 58,088,562 (GRCm39) missense probably damaging 1.00
R7563:Aox1 UTSW 1 58,086,304 (GRCm39) missense probably benign 0.32
R7589:Aox1 UTSW 1 58,080,643 (GRCm39) missense probably damaging 1.00
R7735:Aox1 UTSW 1 58,107,451 (GRCm39) missense probably benign 0.01
R7762:Aox1 UTSW 1 58,388,263 (GRCm39) missense probably damaging 1.00
R7814:Aox1 UTSW 1 58,124,626 (GRCm39) missense probably benign
R7876:Aox1 UTSW 1 58,101,330 (GRCm39) nonsense probably null
R7899:Aox1 UTSW 1 58,320,396 (GRCm39) splice site probably null
R7905:Aox1 UTSW 1 58,143,557 (GRCm39) missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R7942:Aox1 UTSW 1 58,376,590 (GRCm39) missense probably damaging 1.00
R7975:Aox1 UTSW 1 58,348,187 (GRCm39) missense probably benign 0.02
R8029:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R8032:Aox1 UTSW 1 58,389,442 (GRCm39) missense probably benign 0.01
R8116:Aox1 UTSW 1 58,115,283 (GRCm39) missense probably damaging 1.00
R8147:Aox1 UTSW 1 58,339,821 (GRCm39) missense probably benign 0.02
R8165:Aox1 UTSW 1 58,348,088 (GRCm39) missense probably benign 0.08
R8179:Aox1 UTSW 1 58,137,117 (GRCm39) missense probably damaging 1.00
R8264:Aox1 UTSW 1 58,092,873 (GRCm39) missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58,115,250 (GRCm39) missense probably damaging 1.00
R8326:Aox1 UTSW 1 58,335,046 (GRCm39) missense probably benign
R8415:Aox1 UTSW 1 58,080,638 (GRCm39) missense probably damaging 1.00
R8770:Aox1 UTSW 1 58,378,763 (GRCm39) missense probably benign 0.10
R8946:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R8973:Aox1 UTSW 1 58,329,113 (GRCm39) missense probably benign 0.34
R8988:Aox1 UTSW 1 58,088,625 (GRCm39) missense possibly damaging 0.48
R9015:Aox1 UTSW 1 58,382,851 (GRCm39) missense probably damaging 1.00
R9097:Aox1 UTSW 1 58,326,887 (GRCm39) missense possibly damaging 0.82
R9101:Aox1 UTSW 1 58,371,796 (GRCm39) missense probably benign 0.03
R9108:Aox1 UTSW 1 58,321,851 (GRCm39) missense probably damaging 1.00
R9180:Aox1 UTSW 1 58,378,777 (GRCm39) nonsense probably null
R9258:Aox1 UTSW 1 58,351,515 (GRCm39) missense probably damaging 1.00
R9293:Aox1 UTSW 1 58,361,953 (GRCm39) missense possibly damaging 0.86
R9296:Aox1 UTSW 1 58,124,612 (GRCm39) missense probably damaging 1.00
R9382:Aox1 UTSW 1 58,104,501 (GRCm39) missense possibly damaging 0.48
R9461:Aox1 UTSW 1 58,116,736 (GRCm39) critical splice donor site probably null
R9519:Aox1 UTSW 1 58,373,926 (GRCm39) missense probably damaging 0.98
Z1088:Aox1 UTSW 1 58,120,701 (GRCm39) missense probably benign 0.01
Z1177:Aox1 UTSW 1 58,393,556 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGGTTGTCACAAGGTAGATGC -3'
(R):5'- GGAAAAGTGATCAGGGTTGTTC -3'

Sequencing Primer
(F):5'- TCAATGATGGCAGCTTCCAG -3'
(R):5'- CTTTTATTGTTGATGAGAACAGGAAC -3'
Posted On 2022-08-09