Incidental Mutation 'R9581:Aox2'
ID 722517
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 58330896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366] [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably null
Transcript: ENSMUST00000114366
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114366
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,740,428 I1097R possibly damaging Het
Abcd4 A G 12: 84,603,988 S533P probably damaging Het
Adat1 C T 8: 111,979,314 V387I probably benign Het
Aff3 T A 1: 38,210,185 T614S probably benign Het
Aldh1a1 T A 19: 20,620,053 C133S probably benign Het
Ankrd12 A G 17: 65,983,420 S1673P probably damaging Het
Arsi A G 18: 60,917,088 T348A probably damaging Het
Baz2b T C 2: 59,968,956 R275G probably benign Het
Cdh2 T A 18: 16,670,055 probably benign Het
Cela1 C T 15: 100,675,380 A243T probably benign Het
Cep192 G T 18: 67,847,394 V1409F probably damaging Het
Chia1 T C 3: 106,128,563 Y240H possibly damaging Het
Dact1 A T 12: 71,318,845 K763M probably damaging Het
Dip2b C A 15: 100,181,374 N822K probably damaging Het
Dnah12 C T 14: 26,770,028 T1140I probably damaging Het
Drc7 T C 8: 95,059,154 S213P probably damaging Het
Ell2 A G 13: 75,764,029 D478G probably benign Het
Evpl G A 11: 116,229,834 T483M probably benign Het
Farp1 A T 14: 121,243,429 E414V probably benign Het
Fbxl17 A G 17: 63,499,530 V163A probably benign Het
Foxn3 C T 12: 99,196,776 E289K probably damaging Het
Fscb T A 12: 64,474,348 I115F probably benign Het
Gm14496 A T 2: 182,000,254 T573S probably benign Het
Golga1 G T 2: 39,019,561 D677E probably damaging Het
Herc6 A T 6: 57,658,116 K772N probably damaging Het
Ikbkb T C 8: 22,665,559 D639G probably damaging Het
Lrrc61 G A 6: 48,568,719 V159I possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mib1 A G 18: 10,775,701 D551G possibly damaging Het
Muc5ac G T 7: 141,810,062 R2370L unknown Het
Mybpc3 A G 2: 91,119,271 D53G probably benign Het
Myo9b C T 8: 71,359,899 P2105S probably benign Het
Naip5 G T 13: 100,214,686 H1271Q probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nmt2 T C 2: 3,316,175 V340A possibly damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Nox3 G A 17: 3,650,053 R462W possibly damaging Het
Olfr243 A G 7: 103,716,581 probably benign Het
Olfr63 C A 17: 33,269,021 A99D probably damaging Het
Pcdhgc4 A G 18: 37,817,136 Q535R probably benign Het
Pcsk5 T C 19: 17,454,832 D1473G probably benign Het
Pdilt A T 7: 119,500,410 F212I probably damaging Het
Ptk2b A T 14: 66,213,340 V59D probably damaging Het
Ptprf T C 4: 118,235,060 D571G probably benign Het
Ptprq A T 10: 107,711,910 V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Schip1 TCTGGCC TC 3: 68,617,727 probably null Het
Sec16a C T 2: 26,438,635 V142I Het
Slamf6 A G 1: 171,934,330 Y106C Het
Strc A G 2: 121,377,447 V481A probably damaging Het
Sulf1 A T 1: 12,805,254 I163F possibly damaging Het
Tjp1 A G 7: 65,299,724 S1637P probably damaging Het
Tlr9 A G 9: 106,224,311 E267G probably damaging Het
Tmem117 T A 15: 95,094,387 F309L probably benign Het
Tmtc4 T C 14: 122,950,586 N196S probably benign Het
Trim16 T A 11: 62,836,731 I293K probably damaging Het
Trim7 T C 11: 48,848,060 V95A probably damaging Het
Ttll6 A T 11: 96,158,746 K763N probably benign Het
Tut1 T C 19: 8,964,617 S483P probably benign Het
Zfp101 A T 17: 33,386,756 L26* probably null Het
Zfp106 C T 2: 120,535,326 R155K Het
Zfp518a T A 19: 40,911,712 D28E probably damaging Het
Zfp90 T A 8: 106,425,082 S476T probably benign Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGGTTGTCACAAGGTAGATGC -3'
(R):5'- GGAAAAGTGATCAGGGTTGTTC -3'

Sequencing Primer
(F):5'- TCAATGATGGCAGCTTCCAG -3'
(R):5'- CTTTTATTGTTGATGAGAACAGGAAC -3'
Posted On 2022-08-09