Incidental Mutation 'R9581:Sec16a'
ID 722520
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene Name SEC16 homolog A, endoplasmic reticulum export factor
Synonyms C230052J16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26299443-26335228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26328647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 142 (V142I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
AlphaFold E9QAT4
Predicted Effect probably benign
Transcript: ENSMUST00000091252
AA Change: V1123I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: V1123I

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
AA Change: V1123I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: V1123I

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924
AA Change: V142I

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Aox1 T A 1: 58,370,055 (GRCm39) probably null Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dip2b C A 15: 100,079,255 (GRCm39) N822K probably damaging Het
Dnah12 C T 14: 26,491,985 (GRCm39) T1140I probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprf T C 4: 118,092,257 (GRCm39) D571G probably benign Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Strc A G 2: 121,207,928 (GRCm39) V481A probably damaging Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26,329,499 (GRCm39) missense probably benign 0.15
IGL00435:Sec16a APN 2 26,320,113 (GRCm39) missense probably benign 0.00
IGL00469:Sec16a APN 2 26,318,312 (GRCm39) missense probably damaging 1.00
IGL01622:Sec16a APN 2 26,328,915 (GRCm39) missense probably benign 0.00
IGL01623:Sec16a APN 2 26,328,915 (GRCm39) missense probably benign 0.00
IGL02158:Sec16a APN 2 26,306,644 (GRCm39) critical splice donor site probably null
IGL02188:Sec16a APN 2 26,326,020 (GRCm39) missense probably damaging 1.00
IGL02445:Sec16a APN 2 26,312,052 (GRCm39) missense probably benign
IGL02568:Sec16a APN 2 26,326,054 (GRCm39) missense probably damaging 1.00
IGL02710:Sec16a APN 2 26,320,142 (GRCm39) missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26,318,149 (GRCm39) splice site probably benign
IGL02964:Sec16a APN 2 26,309,735 (GRCm39) missense probably benign 0.00
IGL03027:Sec16a APN 2 26,313,601 (GRCm39) missense probably benign 0.13
IGL03073:Sec16a APN 2 26,329,195 (GRCm39) missense probably benign 0.02
IGL03297:Sec16a APN 2 26,329,202 (GRCm39) missense probably benign 0.05
IGL03339:Sec16a APN 2 26,325,945 (GRCm39) missense probably benign
H8562:Sec16a UTSW 2 26,331,517 (GRCm39) missense probably benign
IGL03050:Sec16a UTSW 2 26,305,759 (GRCm39) missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26,315,785 (GRCm39) missense
R0039:Sec16a UTSW 2 26,313,926 (GRCm39) missense probably benign 0.03
R0095:Sec16a UTSW 2 26,315,772 (GRCm39) splice site probably null
R0095:Sec16a UTSW 2 26,315,772 (GRCm39) splice site probably null
R0189:Sec16a UTSW 2 26,314,426 (GRCm39) splice site probably null
R0255:Sec16a UTSW 2 26,321,198 (GRCm39) missense probably damaging 0.97
R0278:Sec16a UTSW 2 26,318,328 (GRCm39) missense probably damaging 1.00
R0739:Sec16a UTSW 2 26,331,063 (GRCm39) missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26,309,734 (GRCm39) missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26,313,579 (GRCm39) missense probably benign 0.00
R1466:Sec16a UTSW 2 26,321,169 (GRCm39) missense probably damaging 0.98
R1466:Sec16a UTSW 2 26,321,169 (GRCm39) missense probably damaging 0.98
R1501:Sec16a UTSW 2 26,330,057 (GRCm39) missense probably benign 0.16
R1524:Sec16a UTSW 2 26,318,394 (GRCm39) missense probably damaging 1.00
R1584:Sec16a UTSW 2 26,321,169 (GRCm39) missense probably damaging 0.98
R1649:Sec16a UTSW 2 26,315,536 (GRCm39) missense probably damaging 1.00
R1744:Sec16a UTSW 2 26,329,198 (GRCm39) missense probably damaging 1.00
R1959:Sec16a UTSW 2 26,320,144 (GRCm39) missense probably benign 0.00
R1973:Sec16a UTSW 2 26,316,501 (GRCm39) missense probably damaging 1.00
R2005:Sec16a UTSW 2 26,329,092 (GRCm39) missense probably benign 0.27
R2073:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2074:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2075:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2151:Sec16a UTSW 2 26,303,757 (GRCm39) intron probably benign
R2472:Sec16a UTSW 2 26,329,948 (GRCm39) missense probably damaging 1.00
R2512:Sec16a UTSW 2 26,329,037 (GRCm39) missense probably benign 0.00
R2520:Sec16a UTSW 2 26,331,368 (GRCm39) nonsense probably null
R2571:Sec16a UTSW 2 26,329,343 (GRCm39) missense probably benign 0.08
R3105:Sec16a UTSW 2 26,328,433 (GRCm39) missense probably benign 0.14
R3508:Sec16a UTSW 2 26,315,862 (GRCm39) missense probably damaging 1.00
R3809:Sec16a UTSW 2 26,331,825 (GRCm39) missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26,304,399 (GRCm39) missense probably damaging 0.97
R4292:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4293:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4294:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4576:Sec16a UTSW 2 26,321,131 (GRCm39) nonsense probably null
R4611:Sec16a UTSW 2 26,331,817 (GRCm39) missense probably benign 0.04
R4627:Sec16a UTSW 2 26,321,080 (GRCm39) splice site probably null
R4627:Sec16a UTSW 2 26,319,405 (GRCm39) missense probably damaging 1.00
R4662:Sec16a UTSW 2 26,320,582 (GRCm39) missense probably damaging 1.00
R4665:Sec16a UTSW 2 26,302,970 (GRCm39) intron probably benign
R4906:Sec16a UTSW 2 26,331,979 (GRCm39) unclassified probably benign
R4967:Sec16a UTSW 2 26,302,883 (GRCm39) missense probably benign 0.00
R4983:Sec16a UTSW 2 26,329,531 (GRCm39) missense probably benign
R5033:Sec16a UTSW 2 26,309,661 (GRCm39) missense probably benign 0.00
R5251:Sec16a UTSW 2 26,329,357 (GRCm39) missense probably benign 0.00
R5391:Sec16a UTSW 2 26,330,044 (GRCm39) missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26,330,280 (GRCm39) missense probably benign 0.01
R5530:Sec16a UTSW 2 26,329,264 (GRCm39) missense probably benign 0.00
R5645:Sec16a UTSW 2 26,329,907 (GRCm39) missense probably benign 0.01
R5661:Sec16a UTSW 2 26,329,649 (GRCm39) missense probably benign 0.01
R5770:Sec16a UTSW 2 26,304,402 (GRCm39) missense probably damaging 0.99
R5830:Sec16a UTSW 2 26,330,853 (GRCm39) missense probably benign 0.15
R5866:Sec16a UTSW 2 26,309,650 (GRCm39) missense probably benign 0.00
R5875:Sec16a UTSW 2 26,323,379 (GRCm39) missense probably damaging 1.00
R5906:Sec16a UTSW 2 26,328,843 (GRCm39) missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26,305,651 (GRCm39) missense probably benign 0.05
R6076:Sec16a UTSW 2 26,313,954 (GRCm39) missense probably damaging 1.00
R6091:Sec16a UTSW 2 26,316,482 (GRCm39) missense probably damaging 1.00
R6295:Sec16a UTSW 2 26,318,253 (GRCm39) missense probably damaging 1.00
R6302:Sec16a UTSW 2 26,315,817 (GRCm39) missense probably damaging 1.00
R6309:Sec16a UTSW 2 26,328,583 (GRCm39) missense probably benign 0.00
R6459:Sec16a UTSW 2 26,313,512 (GRCm39) missense probably benign 0.04
R6520:Sec16a UTSW 2 26,316,118 (GRCm39) missense probably damaging 1.00
R6631:Sec16a UTSW 2 26,329,969 (GRCm39) missense probably damaging 1.00
R6657:Sec16a UTSW 2 26,315,876 (GRCm39) nonsense probably null
R6750:Sec16a UTSW 2 26,330,030 (GRCm39) missense probably benign 0.00
R6852:Sec16a UTSW 2 26,331,431 (GRCm39) missense probably damaging 0.99
R6860:Sec16a UTSW 2 26,320,124 (GRCm39) missense probably damaging 1.00
R6967:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6968:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6970:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6991:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6993:Sec16a UTSW 2 26,313,586 (GRCm39) missense probably damaging 0.99
R7009:Sec16a UTSW 2 26,326,014 (GRCm39) nonsense probably null
R7057:Sec16a UTSW 2 26,315,277 (GRCm39) missense probably damaging 1.00
R7186:Sec16a UTSW 2 26,330,715 (GRCm39) nonsense probably null
R7227:Sec16a UTSW 2 26,328,935 (GRCm39) missense probably benign 0.01
R7234:Sec16a UTSW 2 26,329,780 (GRCm39) missense probably damaging 1.00
R7259:Sec16a UTSW 2 26,331,604 (GRCm39) missense probably benign 0.00
R7326:Sec16a UTSW 2 26,329,729 (GRCm39) missense unknown
R7371:Sec16a UTSW 2 26,331,734 (GRCm39) missense probably benign
R7388:Sec16a UTSW 2 26,318,376 (GRCm39) missense
R7414:Sec16a UTSW 2 26,313,643 (GRCm39) missense
R7417:Sec16a UTSW 2 26,311,409 (GRCm39) missense
R7501:Sec16a UTSW 2 26,331,863 (GRCm39) missense probably damaging 1.00
R7558:Sec16a UTSW 2 26,329,746 (GRCm39) missense
R7696:Sec16a UTSW 2 26,305,645 (GRCm39) critical splice donor site probably null
R7981:Sec16a UTSW 2 26,311,384 (GRCm39) critical splice donor site probably null
R8117:Sec16a UTSW 2 26,331,441 (GRCm39) missense probably benign 0.00
R8131:Sec16a UTSW 2 26,300,958 (GRCm39) missense
R8163:Sec16a UTSW 2 26,306,433 (GRCm39) missense
R8825:Sec16a UTSW 2 26,313,586 (GRCm39) missense
R8855:Sec16a UTSW 2 26,329,852 (GRCm39) missense probably benign 0.16
R9165:Sec16a UTSW 2 26,313,645 (GRCm39) missense
R9216:Sec16a UTSW 2 26,304,401 (GRCm39) missense
R9283:Sec16a UTSW 2 26,313,904 (GRCm39) missense
R9506:Sec16a UTSW 2 26,319,384 (GRCm39) critical splice donor site probably null
R9772:Sec16a UTSW 2 26,329,417 (GRCm39) missense possibly damaging 0.87
X0011:Sec16a UTSW 2 26,305,655 (GRCm39) missense probably damaging 1.00
X0034:Sec16a UTSW 2 26,306,709 (GRCm39) missense probably benign 0.07
X0062:Sec16a UTSW 2 26,306,709 (GRCm39) missense probably benign 0.07
Z1088:Sec16a UTSW 2 26,329,105 (GRCm39) missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26,328,760 (GRCm39) missense
Z1177:Sec16a UTSW 2 26,329,333 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGTAGGCATCATACAGGG -3'
(R):5'- AACCAGGATCATTTCTACCAGCAG -3'

Sequencing Primer
(F):5'- TAGGCATCATACAGGGGTCTG -3'
(R):5'- CAGCAGGTAACAAAAGATGCTC -3'
Posted On 2022-08-09