Incidental Mutation 'R9581:Strc'
ID 722525
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Name stereocilin
Synonyms DFNB16
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 121193729-121211851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121207928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 481 (V481A)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: V481A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: V481A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Aox1 T A 1: 58,370,055 (GRCm39) probably null Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dip2b C A 15: 100,079,255 (GRCm39) N822K probably damaging Het
Dnah12 C T 14: 26,491,985 (GRCm39) T1140I probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprf T C 4: 118,092,257 (GRCm39) D571G probably benign Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Sec16a C T 2: 26,328,647 (GRCm39) V142I Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121,195,541 (GRCm39) missense probably benign 0.39
IGL01152:Strc APN 2 121,201,276 (GRCm39) missense probably benign
IGL01608:Strc APN 2 121,206,075 (GRCm39) missense probably benign 0.05
IGL01695:Strc APN 2 121,205,779 (GRCm39) missense probably damaging 1.00
IGL01715:Strc APN 2 121,196,218 (GRCm39) splice site probably null
IGL01906:Strc APN 2 121,208,115 (GRCm39) missense probably benign
IGL02135:Strc APN 2 121,195,315 (GRCm39) missense probably damaging 1.00
IGL02416:Strc APN 2 121,199,539 (GRCm39) missense probably damaging 1.00
IGL02455:Strc APN 2 121,206,272 (GRCm39) unclassified probably benign
IGL03029:Strc APN 2 121,194,525 (GRCm39) missense possibly damaging 0.95
IGL03176:Strc APN 2 121,202,661 (GRCm39) missense probably damaging 0.99
IGL03272:Strc APN 2 121,202,232 (GRCm39) missense probably damaging 1.00
3-1:Strc UTSW 2 121,204,161 (GRCm39) missense probably damaging 0.99
IGL02799:Strc UTSW 2 121,209,717 (GRCm39) missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121,205,788 (GRCm39) missense probably damaging 1.00
R0022:Strc UTSW 2 121,198,874 (GRCm39) missense probably damaging 1.00
R0494:Strc UTSW 2 121,210,014 (GRCm39) missense probably damaging 0.99
R1065:Strc UTSW 2 121,197,132 (GRCm39) missense probably damaging 1.00
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1203:Strc UTSW 2 121,202,604 (GRCm39) missense possibly damaging 0.66
R1343:Strc UTSW 2 121,195,596 (GRCm39) missense probably benign 0.21
R1544:Strc UTSW 2 121,203,219 (GRCm39) splice site probably null
R1650:Strc UTSW 2 121,211,366 (GRCm39) start gained probably benign
R1840:Strc UTSW 2 121,209,777 (GRCm39) missense probably damaging 1.00
R1983:Strc UTSW 2 121,201,518 (GRCm39) missense possibly damaging 0.54
R2035:Strc UTSW 2 121,205,415 (GRCm39) missense probably damaging 1.00
R2058:Strc UTSW 2 121,209,368 (GRCm39) missense probably damaging 1.00
R2158:Strc UTSW 2 121,196,343 (GRCm39) missense probably benign 0.10
R2219:Strc UTSW 2 121,195,004 (GRCm39) missense probably damaging 1.00
R2680:Strc UTSW 2 121,195,592 (GRCm39) missense probably damaging 0.99
R4375:Strc UTSW 2 121,211,304 (GRCm39) missense unknown
R4563:Strc UTSW 2 121,196,286 (GRCm39) missense probably benign 0.02
R4578:Strc UTSW 2 121,208,484 (GRCm39) missense possibly damaging 0.94
R4607:Strc UTSW 2 121,203,426 (GRCm39) missense probably benign 0.31
R4651:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4652:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4790:Strc UTSW 2 121,206,075 (GRCm39) missense probably benign 0.05
R5480:Strc UTSW 2 121,195,300 (GRCm39) missense probably benign 0.00
R5580:Strc UTSW 2 121,205,493 (GRCm39) missense probably damaging 0.99
R5679:Strc UTSW 2 121,198,581 (GRCm39) missense probably benign 0.03
R5703:Strc UTSW 2 121,201,295 (GRCm39) missense probably benign
R5841:Strc UTSW 2 121,196,358 (GRCm39) missense probably benign 0.29
R5917:Strc UTSW 2 121,209,790 (GRCm39) missense probably benign
R5958:Strc UTSW 2 121,207,403 (GRCm39) missense possibly damaging 0.56
R6320:Strc UTSW 2 121,205,439 (GRCm39) missense probably benign 0.16
R6619:Strc UTSW 2 121,198,913 (GRCm39) missense probably damaging 0.99
R6695:Strc UTSW 2 121,207,705 (GRCm39) missense probably benign 0.35
R6970:Strc UTSW 2 121,208,495 (GRCm39) missense probably benign 0.41
R7018:Strc UTSW 2 121,199,539 (GRCm39) missense probably damaging 1.00
R7045:Strc UTSW 2 121,201,207 (GRCm39) missense probably damaging 1.00
R7190:Strc UTSW 2 121,199,507 (GRCm39) missense probably benign 0.14
R7283:Strc UTSW 2 121,209,933 (GRCm39) missense probably damaging 0.99
R7694:Strc UTSW 2 121,207,577 (GRCm39) missense probably damaging 1.00
R7699:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7700:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7756:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7758:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7822:Strc UTSW 2 121,208,219 (GRCm39) missense probably benign 0.01
R7830:Strc UTSW 2 121,205,530 (GRCm39) missense probably damaging 0.99
R7953:Strc UTSW 2 121,207,844 (GRCm39) missense probably damaging 0.99
R8137:Strc UTSW 2 121,197,219 (GRCm39) missense probably damaging 0.98
R8394:Strc UTSW 2 121,209,490 (GRCm39) missense probably benign 0.00
R8427:Strc UTSW 2 121,208,012 (GRCm39) missense probably damaging 1.00
R8792:Strc UTSW 2 121,208,286 (GRCm39) missense probably damaging 0.99
R8874:Strc UTSW 2 121,205,353 (GRCm39) critical splice donor site probably null
R8947:Strc UTSW 2 121,201,470 (GRCm39) missense probably benign 0.09
R9285:Strc UTSW 2 121,195,279 (GRCm39) missense probably damaging 1.00
R9302:Strc UTSW 2 121,211,336 (GRCm39) missense unknown
R9386:Strc UTSW 2 121,198,211 (GRCm39) missense probably damaging 0.99
R9438:Strc UTSW 2 121,198,647 (GRCm39) missense probably damaging 1.00
Z1176:Strc UTSW 2 121,209,525 (GRCm39) missense probably damaging 1.00
Z1176:Strc UTSW 2 121,206,002 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTGGAAAATCAGTGGCGTC -3'
(R):5'- CTCCTAGCACAGCTGTCATCTG -3'

Sequencing Primer
(F):5'- TGAACCCAAGCCTGGTTC -3'
(R):5'- ATCTGCCAGACAGCTGTATG -3'
Posted On 2022-08-09