Incidental Mutation 'R9581:Ptprf'
ID 722529
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Name protein tyrosine phosphatase receptor type F
Synonyms RPTP-LAR, LAR
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.657) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118065410-118148602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118092257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 571 (D571G)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]
AlphaFold A2A8L5
PDB Structure Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: D571G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: D571G

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: D95G

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: D238G

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222620
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Aox1 T A 1: 58,370,055 (GRCm39) probably null Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dip2b C A 15: 100,079,255 (GRCm39) N822K probably damaging Het
Dnah12 C T 14: 26,491,985 (GRCm39) T1140I probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Sec16a C T 2: 26,328,647 (GRCm39) V142I Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Strc A G 2: 121,207,928 (GRCm39) V481A probably damaging Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118,080,417 (GRCm39) splice site probably benign
IGL01337:Ptprf APN 4 118,093,488 (GRCm39) missense probably damaging 1.00
IGL01482:Ptprf APN 4 118,069,651 (GRCm39) missense probably damaging 1.00
IGL01743:Ptprf APN 4 118,106,095 (GRCm39) critical splice donor site probably null
IGL01987:Ptprf APN 4 118,134,567 (GRCm39) missense probably benign
IGL02189:Ptprf APN 4 118,070,839 (GRCm39) splice site probably benign
IGL03067:Ptprf APN 4 118,067,910 (GRCm39) missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118,070,809 (GRCm39) missense probably damaging 1.00
R0382:Ptprf UTSW 4 118,080,591 (GRCm39) splice site probably benign
R0788:Ptprf UTSW 4 118,083,663 (GRCm39) missense probably damaging 0.97
R1164:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R1478:Ptprf UTSW 4 118,069,302 (GRCm39) nonsense probably null
R1483:Ptprf UTSW 4 118,093,161 (GRCm39) missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118,093,430 (GRCm39) missense probably benign 0.34
R1721:Ptprf UTSW 4 118,082,096 (GRCm39) missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118,080,462 (GRCm39) missense probably benign 0.02
R1818:Ptprf UTSW 4 118,067,068 (GRCm39) missense probably damaging 1.00
R1860:Ptprf UTSW 4 118,081,129 (GRCm39) missense probably damaging 1.00
R2208:Ptprf UTSW 4 118,126,369 (GRCm39) splice site probably benign
R2406:Ptprf UTSW 4 118,126,501 (GRCm39) missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118,106,177 (GRCm39) missense probably damaging 0.98
R3111:Ptprf UTSW 4 118,068,629 (GRCm39) missense probably damaging 1.00
R3498:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3499:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3615:Ptprf UTSW 4 118,095,080 (GRCm39) missense probably benign 0.04
R3616:Ptprf UTSW 4 118,095,080 (GRCm39) missense probably benign 0.04
R4038:Ptprf UTSW 4 118,114,805 (GRCm39) missense probably damaging 1.00
R4243:Ptprf UTSW 4 118,083,649 (GRCm39) critical splice donor site probably null
R4260:Ptprf UTSW 4 118,083,280 (GRCm39) missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118,068,219 (GRCm39) missense probably benign 0.16
R4726:Ptprf UTSW 4 118,069,414 (GRCm39) missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118,082,236 (GRCm39) missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118,067,526 (GRCm39) intron probably benign
R4857:Ptprf UTSW 4 118,074,394 (GRCm39) splice site probably benign
R5071:Ptprf UTSW 4 118,069,196 (GRCm39) missense probably damaging 1.00
R5221:Ptprf UTSW 4 118,082,305 (GRCm39) missense probably benign 0.00
R5327:Ptprf UTSW 4 118,093,586 (GRCm39) missense probably damaging 1.00
R5336:Ptprf UTSW 4 118,092,831 (GRCm39) missense probably damaging 1.00
R5356:Ptprf UTSW 4 118,083,535 (GRCm39) missense probably benign 0.00
R5373:Ptprf UTSW 4 118,083,238 (GRCm39) missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118,082,121 (GRCm39) missense probably damaging 1.00
R5693:Ptprf UTSW 4 118,093,374 (GRCm39) nonsense probably null
R5860:Ptprf UTSW 4 118,068,486 (GRCm39) intron probably benign
R5869:Ptprf UTSW 4 118,067,579 (GRCm39) missense probably damaging 1.00
R5890:Ptprf UTSW 4 118,081,932 (GRCm39) missense probably benign
R5932:Ptprf UTSW 4 118,068,964 (GRCm39) missense probably benign 0.10
R6028:Ptprf UTSW 4 118,070,826 (GRCm39) missense probably benign 0.01
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6088:Ptprf UTSW 4 118,067,952 (GRCm39) missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118,068,281 (GRCm39) missense probably damaging 0.99
R6108:Ptprf UTSW 4 118,080,453 (GRCm39) missense probably benign 0.01
R6320:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R6741:Ptprf UTSW 4 118,080,565 (GRCm39) missense probably benign 0.00
R6744:Ptprf UTSW 4 118,093,562 (GRCm39) missense probably benign 0.00
R6750:Ptprf UTSW 4 118,088,928 (GRCm39) missense probably benign 0.03
R6906:Ptprf UTSW 4 118,126,474 (GRCm39) missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118,081,101 (GRCm39) missense probably benign 0.00
R7153:Ptprf UTSW 4 118,088,740 (GRCm39) missense probably damaging 1.00
R7326:Ptprf UTSW 4 118,088,866 (GRCm39) missense probably damaging 0.99
R7337:Ptprf UTSW 4 118,068,322 (GRCm39) missense probably damaging 0.99
R7374:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R7375:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R7399:Ptprf UTSW 4 118,083,720 (GRCm39) missense probably benign 0.28
R7417:Ptprf UTSW 4 118,069,369 (GRCm39) missense probably damaging 1.00
R7448:Ptprf UTSW 4 118,092,864 (GRCm39) missense probably benign 0.03
R7530:Ptprf UTSW 4 118,069,945 (GRCm39) missense probably damaging 1.00
R7593:Ptprf UTSW 4 118,069,593 (GRCm39) missense probably benign 0.00
R8172:Ptprf UTSW 4 118,068,275 (GRCm39) missense probably benign 0.03
R8239:Ptprf UTSW 4 118,069,309 (GRCm39) missense possibly damaging 0.88
R8257:Ptprf UTSW 4 118,083,476 (GRCm39) missense probably damaging 0.96
R8331:Ptprf UTSW 4 118,083,263 (GRCm39) missense probably benign 0.27
R8441:Ptprf UTSW 4 118,075,255 (GRCm39) splice site probably benign
R8681:Ptprf UTSW 4 118,088,844 (GRCm39) missense probably benign 0.02
R8771:Ptprf UTSW 4 118,068,987 (GRCm39) missense possibly damaging 0.95
R8815:Ptprf UTSW 4 118,095,125 (GRCm39) missense possibly damaging 0.52
R8998:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R8999:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R9389:Ptprf UTSW 4 118,093,236 (GRCm39) missense probably benign
R9508:Ptprf UTSW 4 118,126,776 (GRCm39) nonsense probably null
X0067:Ptprf UTSW 4 118,093,223 (GRCm39) missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118,126,812 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACCACCCATCTGCTTGAAAGG -3'
(R):5'- ATGAGTCACGCCATGCATTTC -3'

Sequencing Primer
(F):5'- CACCCATCTGCTTGAAAGGGAATG -3'
(R):5'- CATTTCTTGCAAGGCTGTGTGAC -3'
Posted On 2022-08-09