Incidental Mutation 'R9581:Dnah12'
ID 722558
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26491985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1140 (T1140I)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: T1140I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: T1140I

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073309
SMART Domains Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879

DomainStartEndE-ValueType
Pfam:AAA_6 1 203 4e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Aox1 T A 1: 58,370,055 (GRCm39) probably null Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dip2b C A 15: 100,079,255 (GRCm39) N822K probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprf T C 4: 118,092,257 (GRCm39) D571G probably benign Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Sec16a C T 2: 26,328,647 (GRCm39) V142I Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Strc A G 2: 121,207,928 (GRCm39) V481A probably damaging Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,488,098 (GRCm39) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,523,470 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,428,036 (GRCm39) missense probably benign
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,443,275 (GRCm39) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATCTTCACCCTTCTTATGCATG -3'
(R):5'- TGGTCTGCTTAGACAACTTCCC -3'

Sequencing Primer
(F):5'- TTCATCAAAAACTTTGGCAACTAACC -3'
(R):5'- ACCAGCTCCACAATGTCATTTAGTTG -3'
Posted On 2022-08-09