Incidental Mutation 'R9581:Dip2b'
ID 722563
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100181374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 822 (N822K)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: N588K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: N588K

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: N822K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: N822K

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,740,428 I1097R possibly damaging Het
Abcd4 A G 12: 84,603,988 S533P probably damaging Het
Adat1 C T 8: 111,979,314 V387I probably benign Het
Aff3 T A 1: 38,210,185 T614S probably benign Het
Aldh1a1 T A 19: 20,620,053 C133S probably benign Het
Ankrd12 A G 17: 65,983,420 S1673P probably damaging Het
Aox2 T A 1: 58,330,896 probably null Het
Arsi A G 18: 60,917,088 T348A probably damaging Het
Baz2b T C 2: 59,968,956 R275G probably benign Het
Cdh2 T A 18: 16,670,055 probably benign Het
Cela1 C T 15: 100,675,380 A243T probably benign Het
Cep192 G T 18: 67,847,394 V1409F probably damaging Het
Chia1 T C 3: 106,128,563 Y240H possibly damaging Het
Dact1 A T 12: 71,318,845 K763M probably damaging Het
Dnah12 C T 14: 26,770,028 T1140I probably damaging Het
Drc7 T C 8: 95,059,154 S213P probably damaging Het
Ell2 A G 13: 75,764,029 D478G probably benign Het
Evpl G A 11: 116,229,834 T483M probably benign Het
Farp1 A T 14: 121,243,429 E414V probably benign Het
Fbxl17 A G 17: 63,499,530 V163A probably benign Het
Foxn3 C T 12: 99,196,776 E289K probably damaging Het
Fscb T A 12: 64,474,348 I115F probably benign Het
Gm14496 A T 2: 182,000,254 T573S probably benign Het
Golga1 G T 2: 39,019,561 D677E probably damaging Het
Herc6 A T 6: 57,658,116 K772N probably damaging Het
Ikbkb T C 8: 22,665,559 D639G probably damaging Het
Lrrc61 G A 6: 48,568,719 V159I possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mib1 A G 18: 10,775,701 D551G possibly damaging Het
Muc5ac G T 7: 141,810,062 R2370L unknown Het
Mybpc3 A G 2: 91,119,271 D53G probably benign Het
Myo9b C T 8: 71,359,899 P2105S probably benign Het
Naip5 G T 13: 100,214,686 H1271Q probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nmt2 T C 2: 3,316,175 V340A possibly damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Nox3 G A 17: 3,650,053 R462W possibly damaging Het
Olfr243 A G 7: 103,716,581 probably benign Het
Olfr63 C A 17: 33,269,021 A99D probably damaging Het
Pcdhgc4 A G 18: 37,817,136 Q535R probably benign Het
Pcsk5 T C 19: 17,454,832 D1473G probably benign Het
Pdilt A T 7: 119,500,410 F212I probably damaging Het
Ptk2b A T 14: 66,213,340 V59D probably damaging Het
Ptprf T C 4: 118,235,060 D571G probably benign Het
Ptprq A T 10: 107,711,910 V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Schip1 TCTGGCC TC 3: 68,617,727 probably null Het
Sec16a C T 2: 26,438,635 V142I Het
Slamf6 A G 1: 171,934,330 Y106C Het
Strc A G 2: 121,377,447 V481A probably damaging Het
Sulf1 A T 1: 12,805,254 I163F possibly damaging Het
Tjp1 A G 7: 65,299,724 S1637P probably damaging Het
Tlr9 A G 9: 106,224,311 E267G probably damaging Het
Tmem117 T A 15: 95,094,387 F309L probably benign Het
Tmtc4 T C 14: 122,950,586 N196S probably benign Het
Trim16 T A 11: 62,836,731 I293K probably damaging Het
Trim7 T C 11: 48,848,060 V95A probably damaging Het
Ttll6 A T 11: 96,158,746 K763N probably benign Het
Tut1 T C 19: 8,964,617 S483P probably benign Het
Zfp101 A T 17: 33,386,756 L26* probably null Het
Zfp106 C T 2: 120,535,326 R155K Het
Zfp518a T A 19: 40,911,712 D28E probably damaging Het
Zfp90 T A 8: 106,425,082 S476T probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9477:Dip2b UTSW 15 100038903 missense probably damaging 1.00
R9485:Dip2b UTSW 15 100155043 missense probably benign 0.05
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9666:Dip2b UTSW 15 100209580 missense probably damaging 1.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGTGTACATGTTTCACAGG -3'
(R):5'- TTTCATGCCTCAGCTGCAGG -3'

Sequencing Primer
(F):5'- ACATGTTTCACAGGTACGTTTC -3'
(R):5'- CTGCAGGACGGGTATTTAAAGCTG -3'
Posted On 2022-08-09