Incidental Mutation 'R9581:Dip2b'
ID 722563
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R9581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100079255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 822 (N822K)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: N588K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: N588K

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: N822K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: N822K

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T G 5: 8,790,428 (GRCm39) I1097R possibly damaging Het
Abcd4 A G 12: 84,650,762 (GRCm39) S533P probably damaging Het
Adat1 C T 8: 112,705,946 (GRCm39) V387I probably benign Het
Aff3 T A 1: 38,249,266 (GRCm39) T614S probably benign Het
Aldh1a1 T A 19: 20,597,417 (GRCm39) C133S probably benign Het
Ankrd12 A G 17: 66,290,415 (GRCm39) S1673P probably damaging Het
Aox1 T A 1: 58,370,055 (GRCm39) probably null Het
Arsi A G 18: 61,050,160 (GRCm39) T348A probably damaging Het
Baz2b T C 2: 59,799,300 (GRCm39) R275G probably benign Het
Cdh2 T A 18: 16,803,112 (GRCm39) probably benign Het
Cela1 C T 15: 100,573,261 (GRCm39) A243T probably benign Het
Cep192 G T 18: 67,980,465 (GRCm39) V1409F probably damaging Het
Chia1 T C 3: 106,035,879 (GRCm39) Y240H possibly damaging Het
Dact1 A T 12: 71,365,619 (GRCm39) K763M probably damaging Het
Dnah12 C T 14: 26,491,985 (GRCm39) T1140I probably damaging Het
Drc7 T C 8: 95,785,782 (GRCm39) S213P probably damaging Het
Ell2 A G 13: 75,912,148 (GRCm39) D478G probably benign Het
Evpl G A 11: 116,120,660 (GRCm39) T483M probably benign Het
Farp1 A T 14: 121,480,841 (GRCm39) E414V probably benign Het
Fbxl17 A G 17: 63,806,525 (GRCm39) V163A probably benign Het
Foxn3 C T 12: 99,163,035 (GRCm39) E289K probably damaging Het
Fscb T A 12: 64,521,122 (GRCm39) I115F probably benign Het
Gm14496 A T 2: 181,642,047 (GRCm39) T573S probably benign Het
Golga1 G T 2: 38,909,573 (GRCm39) D677E probably damaging Het
Herc6 A T 6: 57,635,101 (GRCm39) K772N probably damaging Het
Ikbkb T C 8: 23,155,575 (GRCm39) D639G probably damaging Het
Lrrc61 G A 6: 48,545,653 (GRCm39) V159I possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mib1 A G 18: 10,775,701 (GRCm39) D551G possibly damaging Het
Muc5ac G T 7: 141,363,799 (GRCm39) R2370L unknown Het
Mybpc3 A G 2: 90,949,616 (GRCm39) D53G probably benign Het
Myo9b C T 8: 71,812,543 (GRCm39) P2105S probably benign Het
Naip5 G T 13: 100,351,194 (GRCm39) H1271Q probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nmt2 T C 2: 3,317,212 (GRCm39) V340A possibly damaging Het
Nos1 A G 5: 118,043,459 (GRCm39) E578G probably damaging Het
Nox3 G A 17: 3,700,328 (GRCm39) R462W possibly damaging Het
Or10h28 C A 17: 33,487,995 (GRCm39) A99D probably damaging Het
Or52a20 A G 7: 103,365,788 (GRCm39) probably benign Het
Pcdhgc4 A G 18: 37,950,189 (GRCm39) Q535R probably benign Het
Pcsk5 T C 19: 17,432,196 (GRCm39) D1473G probably benign Het
Pdilt A T 7: 119,099,633 (GRCm39) F212I probably damaging Het
Ptk2b A T 14: 66,450,789 (GRCm39) V59D probably damaging Het
Ptprf T C 4: 118,092,257 (GRCm39) D571G probably benign Het
Ptprq A T 10: 107,547,771 (GRCm39) V209E possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Schip1 TCTGGCC TC 3: 68,525,060 (GRCm39) probably null Het
Sec16a C T 2: 26,328,647 (GRCm39) V142I Het
Slamf6 A G 1: 171,761,897 (GRCm39) Y106C Het
Strc A G 2: 121,207,928 (GRCm39) V481A probably damaging Het
Sulf1 A T 1: 12,875,478 (GRCm39) I163F possibly damaging Het
Tjp1 A G 7: 64,949,472 (GRCm39) S1637P probably damaging Het
Tlr9 A G 9: 106,101,510 (GRCm39) E267G probably damaging Het
Tmem117 T A 15: 94,992,268 (GRCm39) F309L probably benign Het
Tmtc4 T C 14: 123,187,998 (GRCm39) N196S probably benign Het
Trim16 T A 11: 62,727,557 (GRCm39) I293K probably damaging Het
Trim7 T C 11: 48,738,887 (GRCm39) V95A probably damaging Het
Ttll6 A T 11: 96,049,572 (GRCm39) K763N probably benign Het
Tut1 T C 19: 8,941,981 (GRCm39) S483P probably benign Het
Zfp101 A T 17: 33,605,730 (GRCm39) L26* probably null Het
Zfp106 C T 2: 120,365,807 (GRCm39) R155K Het
Zfp518a T A 19: 40,900,156 (GRCm39) D28E probably damaging Het
Zfp90 T A 8: 107,151,714 (GRCm39) S476T probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGTGTACATGTTTCACAGG -3'
(R):5'- TTTCATGCCTCAGCTGCAGG -3'

Sequencing Primer
(F):5'- ACATGTTTCACAGGTACGTTTC -3'
(R):5'- CTGCAGGACGGGTATTTAAAGCTG -3'
Posted On 2022-08-09