Incidental Mutation 'R9582:Ces1a'
ID 722608
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Name carboxylesterase 1A
Synonyms Gm4976
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9582 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 93020214-93048192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93039528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 153 (D153N)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
AlphaFold E9PYP1
Predicted Effect probably benign
Transcript: ENSMUST00000095211
AA Change: D153N

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: D153N

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,005 F652I probably damaging Het
Adam17 A T 12: 21,336,664 I457K probably benign Het
Arpin T C 7: 79,935,290 probably benign Het
Bhlhe40 A G 6: 108,661,506 E51G probably benign Het
Cog7 T C 7: 121,936,977 M547V probably benign Het
Csrnp2 C T 15: 100,488,186 R57K possibly damaging Het
Dact1 A T 12: 71,318,845 K763M probably damaging Het
Ddost A T 4: 138,308,272 I101F possibly damaging Het
Dyrk1b C T 7: 28,182,603 R130W probably damaging Het
Ep400 A C 5: 110,676,449 probably null Het
Fam227a A G 15: 79,617,777 V532A probably benign Het
Flnc C A 6: 29,460,737 T2609K probably damaging Het
Gbp10 A G 5: 105,224,390 V168A probably benign Het
Gp5 A G 16: 30,308,239 V539A probably benign Het
H2-Bl T A 17: 36,081,483 R33S unknown Het
Itih5 A G 2: 10,190,202 E135G probably benign Het
L2hgdh A G 12: 69,692,398 V433A probably benign Het
Leng9 A G 7: 4,149,264 S138P probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Lypla1 C T 1: 4,841,025 P178S probably benign Het
Mark1 A G 1: 184,919,661 F216L possibly damaging Het
Mertk G A 2: 128,782,607 R646Q possibly damaging Het
Mmp9 A C 2: 164,949,315 D135A probably benign Het
Nefl A G 14: 68,087,400 K529E unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nwd1 A G 8: 72,695,289 T988A probably damaging Het
P4ha2 T A 11: 54,131,239 C529* probably null Het
Pcdhb4 T A 18: 37,308,364 F242L probably damaging Het
Pced1b A G 15: 97,384,569 N163S probably damaging Het
Pde8b A G 13: 95,032,861 V585A probably damaging Het
Pknox2 T A 9: 36,892,956 T432S probably damaging Het
Rad18 A G 6: 112,681,337 probably null Het
Rpgrip1l C T 8: 91,270,258 V665I probably benign Het
Rreb1 A G 13: 37,930,758 I698V probably benign Het
Schip1 TCTGGCC TC 3: 68,617,727 probably null Het
Slc2a4 C T 11: 69,946,624 V32M probably damaging Het
Slc40a1 A G 1: 45,911,339 Y318H probably damaging Het
Spag16 A G 1: 69,858,558 T156A probably benign Het
Srebf1 C A 11: 60,207,042 A103S probably benign Het
Sspn C T 6: 145,953,608 probably benign Het
Stoml2 A T 4: 43,030,238 probably null Het
Stra6 T A 9: 58,147,487 V319E probably damaging Het
Syt7 T C 19: 10,439,416 F414L probably damaging Het
Tet3 G T 6: 83,404,244 P314Q probably damaging Het
Tnrc18 A T 5: 142,771,373 L1313Q Het
Topors A T 4: 40,260,460 D941E unknown Het
Txnip T A 3: 96,558,343 C36* probably null Het
Uba3 A T 6: 97,191,530 M178K probably damaging Het
Vmn1r6 A G 6: 57,002,940 T196A probably benign Het
Vwc2 T A 11: 11,116,129 S72R probably benign Het
Wnk2 A G 13: 49,057,499 S1627P probably benign Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 splice site probably null
R8926:Ces1a UTSW 8 93025213 missense probably benign 0.05
R9365:Ces1a UTSW 8 93048099 missense probably benign 0.00
R9636:Ces1a UTSW 8 93032635 missense probably benign 0.17
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACAGATCTCTCAGAGGATGAAATGAC -3'
(R):5'- TGTGATCTGAGACCAAGTTTAGGG -3'

Sequencing Primer
(F):5'- CTCTCAGAGGATGAAATGACCAGGG -3'
(R):5'- ACCTTTTGTAACCACAATGGGC -3'
Posted On 2022-08-09