Incidental Mutation 'R9584:Hipk3'
ID 722689
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104301910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000028600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably benign
Transcript: ENSMUST00000028600
AA Change: V94A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: V94A

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111124
AA Change: V94A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: V94A

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111125
AA Change: V94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: V94A

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T G 13: 70,949,136 (GRCm39) D175A probably damaging Het
Ankhd1 A T 18: 36,798,504 (GRCm39) N635Y probably benign Het
Asxl2 T C 12: 3,550,667 (GRCm39) V803A possibly damaging Het
Brsk1 T A 7: 4,709,662 (GRCm39) S430T possibly damaging Het
Btbd8 A T 5: 107,658,347 (GRCm39) H1639L probably benign Het
Cacna2d2 T C 9: 107,277,404 (GRCm39) L46P probably damaging Het
Casz1 A G 4: 148,985,704 (GRCm39) probably benign Het
Catsper2 A T 2: 121,230,301 (GRCm39) N344K probably damaging Het
Ccdc80 A G 16: 44,915,675 (GRCm39) S144G probably damaging Het
Cdh10 A T 15: 18,992,095 (GRCm39) L451F probably benign Het
Chil6 A G 3: 106,301,672 (GRCm39) F143L probably damaging Het
Dock7 G A 4: 98,861,481 (GRCm39) R1379* probably null Het
Dop1a C A 9: 86,385,151 (GRCm39) L366I possibly damaging Het
Foxg1 G A 12: 49,432,406 (GRCm39) V380M possibly damaging Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Gm10549 C T 18: 33,597,375 (GRCm39) P54S unknown Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Impg1 T C 9: 80,322,849 (GRCm39) H52R probably benign Het
Kcnv2 T C 19: 27,300,265 (GRCm39) S39P probably damaging Het
Knop1 G A 7: 118,447,709 (GRCm39) S417L unknown Het
Muc1 C T 3: 89,138,373 (GRCm39) T405I probably benign Het
Nlrp2 C A 7: 5,322,215 (GRCm39) D811Y probably damaging Het
Nvl A G 1: 180,958,431 (GRCm39) L206S probably benign Het
Or5ac19 A G 16: 59,089,580 (GRCm39) L150S probably benign Het
Or8g17 G A 9: 38,930,462 (GRCm39) A125V probably damaging Het
Orai3 G T 7: 127,373,177 (GRCm39) R226L probably benign Het
Pacs1 T C 19: 5,322,622 (GRCm39) M99V probably benign Het
Pag1 A G 3: 9,761,214 (GRCm39) S298P probably damaging Het
Pde4c T C 8: 71,200,728 (GRCm39) V419A probably benign Het
Pitpna C A 11: 75,510,368 (GRCm39) N208K probably benign Het
Pnpo C A 11: 96,831,705 (GRCm39) E114* probably null Het
Pou5f2 A G 13: 78,173,592 (GRCm39) E178G possibly damaging Het
Psph G A 5: 129,847,752 (GRCm39) R65C probably damaging Het
Sgsh T C 11: 119,241,789 (GRCm39) S106G possibly damaging Het
Synrg A G 11: 83,900,200 (GRCm39) K724R probably damaging Het
Tet1 A T 10: 62,655,306 (GRCm39) F1538L probably damaging Het
Thada G A 17: 84,733,605 (GRCm39) T1014I probably benign Het
Topbp1 T C 9: 103,219,242 (GRCm39) W1165R probably damaging Het
Trrap G A 5: 144,777,330 (GRCm39) V3043M probably damaging Het
Tshz1 G A 18: 84,033,089 (GRCm39) H440Y probably damaging Het
Vwa8 A G 14: 79,394,549 (GRCm39) D1550G probably benign Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCCATGTTGGTTTGCAAC -3'
(R):5'- AGTAGAGCCAAGCGGTTGTG -3'

Sequencing Primer
(F):5'- CATTGCAGGAAGTATGGACAGTTC -3'
(R):5'- GTGTTTTCCAGGAAAGAACCTATCC -3'
Posted On 2022-08-09