Mutagenetix > Incidental Mutation

Incidental Mutation 'R9584:Casz1'

722695

Institutional Source

Beutler Lab

Gene Symbol

Casz1

Ensembl Gene

ENSMUSG00000028977

Gene Name

castor zinc finger 1

Synonyms

D4Ertd432e, 2410019P08Rik, Cst, castor

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9584 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148804429-148954889 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to G at 148901247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000147270]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000094464

SMART Domains

Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122222

SMART Domains

Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
ZnF_C2H2	1182	1206	1.59e1	SMART
ZnF_C2H2	1242	1266	2.47e1	SMART
ZnF_C2H2	1300	1324	3.47e0	SMART
ZnF_C2H2	1457	1481	7.89e0	SMART
ZnF_C2H2	1515	1537	3.21e1	SMART
ZnF_C2H2	1571	1595	3.99e0	SMART
low complexity region	1632	1649	N/A	INTRINSIC
SCOP:d1qbkb_	1675	1742	2e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147270

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	A	T	5: 107,510,481	H1639L	probably benign	Het
Adamts16	T	G	13: 70,801,017	D175A	probably damaging	Het
Ankhd1	A	T	18: 36,665,451	N635Y	probably benign	Het
Asxl2	T	C	12: 3,500,667	V803A	possibly damaging	Het
Brsk1	T	A	7: 4,706,663	S430T	possibly damaging	Het
Cacna2d2	T	C	9: 107,400,205	L46P	probably damaging	Het
Catsper2	A	T	2: 121,399,820	N344K	probably damaging	Het
Ccdc80	A	G	16: 45,095,312	S144G	probably damaging	Het
Cdh10	A	T	15: 18,992,009	L451F	probably benign	Het
Chil6	A	G	3: 106,394,356	F143L	probably damaging	Het
Dock7	G	A	4: 98,973,244	R1379*	probably null	Het
Dopey1	C	A	9: 86,503,098	L366I	possibly damaging	Het
Foxg1	G	A	12: 49,385,623	V380M	possibly damaging	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Gm10549	C	T	18: 33,464,322	P54S	unknown	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
Hipk3	A	G	2: 104,471,565	V94A	probably benign	Het
Impg1	T	C	9: 80,440,796	H52R	probably benign	Het
Kcnv2	T	C	19: 27,322,865	S39P	probably damaging	Het
Knop1	G	A	7: 118,848,486	S417L	unknown	Het
Muc1	C	T	3: 89,231,066	T405I	probably benign	Het
Nlrp2	C	A	7: 5,319,216	D811Y	probably damaging	Het
Nvl	A	G	1: 181,130,866	L206S	probably benign	Het
Olfr146	G	A	9: 39,019,166	A125V	probably damaging	Het
Olfr201	A	G	16: 59,269,217	L150S	probably benign	Het
Orai3	G	T	7: 127,774,005	R226L	probably benign	Het
Pacs1	T	C	19: 5,272,594	M99V	probably benign	Het
Pag1	A	G	3: 9,696,154	S298P	probably damaging	Het
Pde4c	T	C	8: 70,748,079	V419A	probably benign	Het
Pitpna	C	A	11: 75,619,542	N208K	probably benign	Het
Pnpo	C	A	11: 96,940,879	E114*	probably null	Het
Pou5f2	A	G	13: 78,025,473	E178G	possibly damaging	Het
Psph	G	A	5: 129,770,688	R65C	probably damaging	Het
Sgsh	T	C	11: 119,350,963	S106G	possibly damaging	Het
Synrg	A	G	11: 84,009,374	K724R	probably damaging	Het
Tet1	A	T	10: 62,819,527	F1538L	probably damaging	Het
Thada	G	A	17: 84,426,177	T1014I	probably benign	Het
Topbp1	T	C	9: 103,342,043	W1165R	probably damaging	Het
Trrap	G	A	5: 144,840,520	V3043M	probably damaging	Het
Tshz1	G	A	18: 84,014,964	H440Y	probably damaging	Het
Vwa8	A	G	14: 79,157,109	D1550G	probably benign	Het

Other mutations in Casz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Casz1	APN	4	148929371	missense	probably damaging	1.00
IGL02137:Casz1	APN	4	148933468	missense	possibly damaging	0.71
IGL02176:Casz1	APN	4	148934619	missense	probably damaging	1.00
IGL02629:Casz1	APN	4	148944391	missense	probably benign	0.01
IGL02871:Casz1	APN	4	148944319	missense	possibly damaging	0.93
FR4340:Casz1	UTSW	4	148952302	small deletion	probably benign
G1Funyon:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
H8562:Casz1	UTSW	4	148933451	missense	probably damaging	1.00
R0090:Casz1	UTSW	4	148933411	missense	probably benign	0.00
R0389:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0443:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0550:Casz1	UTSW	4	148952284	small deletion	probably benign
R0597:Casz1	UTSW	4	148944394	missense	probably benign	0.00
R1117:Casz1	UTSW	4	148934595	missense	probably damaging	1.00
R1476:Casz1	UTSW	4	148946171	missense	probably benign	0.05
R1540:Casz1	UTSW	4	148942900	unclassified	probably benign
R1610:Casz1	UTSW	4	148929087	missense	possibly damaging	0.54
R1764:Casz1	UTSW	4	148942900	unclassified	probably benign
R1779:Casz1	UTSW	4	148932937	missense	probably benign	0.00
R1874:Casz1	UTSW	4	148943211	missense	probably damaging	0.99
R1902:Casz1	UTSW	4	148936195	missense	possibly damaging	0.95
R1914:Casz1	UTSW	4	148932958	missense	probably damaging	1.00
R2126:Casz1	UTSW	4	148946064	missense	probably damaging	0.99
R2261:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R2262:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R3874:Casz1	UTSW	4	148939589	intron	probably benign
R4019:Casz1	UTSW	4	148932878	missense	probably benign	0.00
R4355:Casz1	UTSW	4	148952335	missense	unknown
R4420:Casz1	UTSW	4	148948918	missense	possibly damaging	0.90
R4610:Casz1	UTSW	4	148933267	missense	probably damaging	1.00
R4632:Casz1	UTSW	4	148951855	missense	possibly damaging	0.71
R4762:Casz1	UTSW	4	148938981	missense	probably damaging	1.00
R4824:Casz1	UTSW	4	148944571	missense	probably damaging	1.00
R4907:Casz1	UTSW	4	148944541	missense	probably damaging	1.00
R5628:Casz1	UTSW	4	148946096	missense	probably damaging	1.00
R5736:Casz1	UTSW	4	148929410	missense	probably benign	0.00
R5929:Casz1	UTSW	4	148938696	missense	probably damaging	1.00
R5929:Casz1	UTSW	4	148938969	missense	probably damaging	1.00
R5932:Casz1	UTSW	4	148939113	missense	possibly damaging	0.52
R6016:Casz1	UTSW	4	148934584	missense	probably damaging	1.00
R6019:Casz1	UTSW	4	148947038	missense	probably damaging	0.99
R6139:Casz1	UTSW	4	148951697	missense	probably damaging	1.00
R6223:Casz1	UTSW	4	148933383	missense	probably damaging	1.00
R6239:Casz1	UTSW	4	148938277	missense	probably damaging	1.00
R6323:Casz1	UTSW	4	148941704	missense	possibly damaging	0.89
R6354:Casz1	UTSW	4	148952542	missense	unknown
R6454:Casz1	UTSW	4	148951495	missense	probably damaging	0.99
R6479:Casz1	UTSW	4	148937078	missense	probably damaging	1.00
R6529:Casz1	UTSW	4	148938189	missense	probably damaging	1.00
R6772:Casz1	UTSW	4	148943206	missense	probably damaging	1.00
R7000:Casz1	UTSW	4	148929236	missense	probably damaging	1.00
R7152:Casz1	UTSW	4	148901291	start gained	probably benign
R7324:Casz1	UTSW	4	148947033	missense	probably damaging	0.99
R7339:Casz1	UTSW	4	148951745	missense	probably damaging	1.00
R7388:Casz1	UTSW	4	148952393	missense	unknown
R7480:Casz1	UTSW	4	148944586	missense	probably damaging	0.99
R7719:Casz1	UTSW	4	148944524	missense	probably damaging	0.99
R7789:Casz1	UTSW	4	148929406	missense	probably benign
R7801:Casz1	UTSW	4	148938249	missense	probably damaging	0.99
R7815:Casz1	UTSW	4	148929305	missense	possibly damaging	0.89
R7818:Casz1	UTSW	4	148946076	missense	probably damaging	1.00
R7938:Casz1	UTSW	4	148944486	missense	probably benign	0.05
R8045:Casz1	UTSW	4	148932779	missense	probably damaging	1.00
R8134:Casz1	UTSW	4	148943035	missense	probably damaging	1.00
R8165:Casz1	UTSW	4	148944431	missense	probably damaging	1.00
R8301:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
R8419:Casz1	UTSW	4	148948583	missense	probably benign	0.29
R9047:Casz1	UTSW	4	148939040	missense	probably damaging	1.00
R9420:Casz1	UTSW	4	148938863	missense	probably damaging	0.99
RF001:Casz1	UTSW	4	148952304	small deletion	probably benign
RF063:Casz1	UTSW	4	148952304	small deletion	probably benign
X0018:Casz1	UTSW	4	148939008	missense	probably damaging	1.00
X0064:Casz1	UTSW	4	148932952	missense	probably damaging	0.99
Z1088:Casz1	UTSW	4	148944359	missense	probably benign
Z1176:Casz1	UTSW	4	148944359	missense	probably benign
Z1177:Casz1	UTSW	4	148933306	missense	probably damaging	1.00
Z1177:Casz1	UTSW	4	148944359	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGAGCTTTGGGAGAAGTCG -3'
(R):5'- AAAACAGAAACTGCCCGTGG -3'

Sequencing Primer
(F):5'- GGGCGAGTCTGATCTTTCACC -3'
(R):5'- TCGCTCGGCTGGGGATC -3'

Posted On

2022-08-09