Incidental Mutation 'R9584:Olfr146'
ID 722704
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Name olfactory receptor 146
Synonyms GA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 39018073-39023377 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 39019166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 125 (A125V)
Ref Sequence ENSEMBL: ENSMUSP00000151064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
AlphaFold Q60884
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: A125V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: A125V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: A125V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215383
AA Change: A125V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A T 5: 107,510,481 H1639L probably benign Het
Adamts16 T G 13: 70,801,017 D175A probably damaging Het
Ankhd1 A T 18: 36,665,451 N635Y probably benign Het
Asxl2 T C 12: 3,500,667 V803A possibly damaging Het
Brsk1 T A 7: 4,706,663 S430T possibly damaging Het
Cacna2d2 T C 9: 107,400,205 L46P probably damaging Het
Casz1 A G 4: 148,901,247 probably benign Het
Catsper2 A T 2: 121,399,820 N344K probably damaging Het
Ccdc80 A G 16: 45,095,312 S144G probably damaging Het
Cdh10 A T 15: 18,992,009 L451F probably benign Het
Chil6 A G 3: 106,394,356 F143L probably damaging Het
Dock7 G A 4: 98,973,244 R1379* probably null Het
Dopey1 C A 9: 86,503,098 L366I possibly damaging Het
Foxg1 G A 12: 49,385,623 V380M possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hipk3 A G 2: 104,471,565 V94A probably benign Het
Impg1 T C 9: 80,440,796 H52R probably benign Het
Kcnv2 T C 19: 27,322,865 S39P probably damaging Het
Knop1 G A 7: 118,848,486 S417L unknown Het
Muc1 C T 3: 89,231,066 T405I probably benign Het
Nlrp2 C A 7: 5,319,216 D811Y probably damaging Het
Nvl A G 1: 181,130,866 L206S probably benign Het
Olfr201 A G 16: 59,269,217 L150S probably benign Het
Orai3 G T 7: 127,774,005 R226L probably benign Het
Pacs1 T C 19: 5,272,594 M99V probably benign Het
Pag1 A G 3: 9,696,154 S298P probably damaging Het
Pde4c T C 8: 70,748,079 V419A probably benign Het
Pitpna C A 11: 75,619,542 N208K probably benign Het
Pnpo C A 11: 96,940,879 E114* probably null Het
Pou5f2 A G 13: 78,025,473 E178G possibly damaging Het
Psph G A 5: 129,770,688 R65C probably damaging Het
Sgsh T C 11: 119,350,963 S106G possibly damaging Het
Synrg A G 11: 84,009,374 K724R probably damaging Het
Tet1 A T 10: 62,819,527 F1538L probably damaging Het
Thada G A 17: 84,426,177 T1014I probably benign Het
Topbp1 T C 9: 103,342,043 W1165R probably damaging Het
Trrap G A 5: 144,840,520 V3043M probably damaging Het
Tshz1 G A 18: 84,014,964 H440Y probably damaging Het
Vwa8 A G 14: 79,157,109 D1550G probably benign Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R0531:Olfr146 UTSW 9 39019176 missense probably damaging 0.97
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R4788:Olfr146 UTSW 9 39018921 missense probably benign 0.07
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6319:Olfr146 UTSW 9 39019514 missense probably damaging 1.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R6693:Olfr146 UTSW 9 39018801 missense probably damaging 0.98
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
R7947:Olfr146 UTSW 9 39019451 missense probably damaging 0.99
R7957:Olfr146 UTSW 9 39019053 missense probably benign
R8052:Olfr146 UTSW 9 39019487 missense probably damaging 0.99
R8162:Olfr146 UTSW 9 39018953 missense probably benign 0.01
R9004:Olfr146 UTSW 9 39019284 missense probably benign 0.01
R9083:Olfr146 UTSW 9 39018720 missense probably damaging 1.00
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Z1191:Olfr146 UTSW 9 39018933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTAGGATGCTGATAATGATG -3'
(R):5'- TGATCCTGCTCAGCTCGTAC -3'

Sequencing Primer
(F):5'- CGTAGGATGCTGATAATGATGAAAGC -3'
(R):5'- TCAGCTCGTACCTGCACAC -3'
Posted On 2022-08-09