Incidental Mutation 'R9585:1700006A11Rik'
ID 722737
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene Name RIKEN cDNA 1700006A11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 124400989-124426040 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124406344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 533 (D533V)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
AlphaFold B9EHI3
Predicted Effect possibly damaging
Transcript: ENSMUST00000029598
AA Change: D533V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: D533V

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A G 19: 42,052,913 E161G probably benign Het
Abca12 A G 1: 71,303,586 S912P probably damaging Het
Abca3 G A 17: 24,400,512 M1196I probably benign Het
Adprhl2 A T 4: 126,317,993 D175E probably benign Het
Asrgl1 A G 19: 9,113,034 L316P probably benign Het
Avl9 T A 6: 56,757,314 M626K probably damaging Het
Birc6 A G 17: 74,609,270 N1727S probably damaging Het
Casp14 G A 10: 78,713,360 R251W probably damaging Het
Cfap69 A G 5: 5,581,269 I919T possibly damaging Het
Cps1 T A 1: 67,156,182 M254K probably damaging Het
Ctc1 A G 11: 69,034,664 E1009G probably damaging Het
Ddx25 A T 9: 35,543,713 Y426* probably null Het
Dok3 A G 13: 55,524,244 F207S probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fam92b T C 8: 120,174,711 E85G probably null Het
Fcrla A T 1: 170,922,299 M1K probably null Het
Gm10471 T C 5: 26,086,544 H88R possibly damaging Het
Heatr4 A T 12: 83,967,698 S588R probably damaging Het
Iglv3 A G 16: 19,241,210 *123Q probably null Het
Igsf9b T C 9: 27,322,236 I344T probably damaging Het
Il18 T C 9: 50,579,361 S99P probably damaging Het
Krt36 G A 11: 100,104,066 L227F probably damaging Het
Lrriq1 A G 10: 103,215,389 S501P probably benign Het
Lvrn T C 18: 46,878,344 probably null Het
Myo18a T A 11: 77,818,669 M535K probably benign Het
Myocd T A 11: 65,204,366 S158C probably damaging Het
Naip6 A T 13: 100,300,069 C649S probably damaging Het
Oasl2 T C 5: 114,897,840 V59A probably damaging Het
Obscn C A 11: 59,075,005 V2942F probably benign Het
Olfr1157 T A 2: 87,962,575 T106S probably benign Het
Olfr517 T A 7: 108,868,345 T270S probably benign Het
Osbpl6 A G 2: 76,524,094 T18A probably benign Het
Pcf11 A T 7: 92,661,798 D327E probably benign Het
Per3 G T 4: 151,012,681 Q796K probably benign Het
Pex5l T C 3: 33,005,942 T227A probably benign Het
Phf11b G T 14: 59,331,255 P70T probably benign Het
Pkd1l1 T G 11: 8,854,390 I2184L Het
Polr3a A T 14: 24,452,221 M1288K probably damaging Het
Pth1r T A 9: 110,744,779 R3S probably benign Het
Ptprk C A 10: 28,493,151 Y706* probably null Het
Rmi2 C T 16: 10,886,119 T108I probably benign Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Setd3 A C 12: 108,108,555 probably null Het
Slc4a1 A G 11: 102,357,089 Y360H probably benign Het
Sox21 A G 14: 118,235,581 S19P possibly damaging Het
Stx18 T A 5: 38,092,572 N76K possibly damaging Het
Sv2c T C 13: 95,985,958 T437A probably benign Het
Trrap G A 5: 144,840,520 V3043M probably damaging Het
Vps50 T A 6: 3,600,348 S936T probably benign Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
R7124:1700006A11Rik UTSW 3 124414393 missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124414310 critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124412510 missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124407685 missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124412531 missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124419868 missense possibly damaging 0.84
R8201:1700006A11Rik UTSW 3 124401397 missense probably benign 0.00
R9157:1700006A11Rik UTSW 3 124413571 missense probably benign 0.22
R9313:1700006A11Rik UTSW 3 124413571 missense probably benign 0.22
R9683:1700006A11Rik UTSW 3 124406446 missense probably benign 0.01
R9721:1700006A11Rik UTSW 3 124419283 missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCAAACCTCCCTGAAATAGG -3'
(R):5'- GAATTTTGATACTATGAGGTGTCCTAC -3'

Sequencing Primer
(F):5'- TGAAATAGGTCAGTGCCTCATCC -3'
(R):5'- GAGGTGTCCTACAAAAATGTTACTG -3'
Posted On 2022-08-09