Mutagenetix > Incidental Mutation

Incidental Mutation 'R9585:Epha8'

722739

Institutional Source

Beutler Lab

Gene Symbol

Epha8

Ensembl Gene

ENSMUSG00000028661

Gene Name

Eph receptor A8

Synonyms

EphA8, Hek3, Eek

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9585 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

136929419-136956816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136938586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 420 (L420M)

Ref Sequence

ENSEMBL: ENSMUSP00000030420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030420]

AlphaFold

O09127

Predicted Effect

probably damaging
Transcript: ENSMUST00000030420
AA Change: L420M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: L420M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
EPH_lbd	30	203	2.59e-116	SMART
FN3	328	418	4.03e-6	SMART
FN3	439	520	1.67e-12	SMART
Pfam:EphA2_TM	542	631	5.8e-10	PFAM
TyrKc	634	891	1.03e-125	SMART
SAM	926	993	4.74e-19	SMART

Meta Mutation Damage Score

0.1158

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	A	3: 124,406,344	D533V	possibly damaging	Het
4933411K16Rik	A	G	19: 42,052,913	E161G	probably benign	Het
Abca12	A	G	1: 71,303,586	S912P	probably damaging	Het
Abca3	G	A	17: 24,400,512	M1196I	probably benign	Het
Adprhl2	A	T	4: 126,317,993	D175E	probably benign	Het
Asrgl1	A	G	19: 9,113,034	L316P	probably benign	Het
Avl9	T	A	6: 56,757,314	M626K	probably damaging	Het
Birc6	A	G	17: 74,609,270	N1727S	probably damaging	Het
Casp14	G	A	10: 78,713,360	R251W	probably damaging	Het
Cfap69	A	G	5: 5,581,269	I919T	possibly damaging	Het
Cps1	T	A	1: 67,156,182	M254K	probably damaging	Het
Ctc1	A	G	11: 69,034,664	E1009G	probably damaging	Het
Ddx25	A	T	9: 35,543,713	Y426*	probably null	Het
Dok3	A	G	13: 55,524,244	F207S	probably damaging	Het
Fam92b	T	C	8: 120,174,711	E85G	probably null	Het
Fcrla	A	T	1: 170,922,299	M1K	probably null	Het
Gm10471	T	C	5: 26,086,544	H88R	possibly damaging	Het
Heatr4	A	T	12: 83,967,698	S588R	probably damaging	Het
Iglv3	A	G	16: 19,241,210	*123Q	probably null	Het
Igsf9b	T	C	9: 27,322,236	I344T	probably damaging	Het
Il18	T	C	9: 50,579,361	S99P	probably damaging	Het
Krt36	G	A	11: 100,104,066	L227F	probably damaging	Het
Lrriq1	A	G	10: 103,215,389	S501P	probably benign	Het
Lvrn	T	C	18: 46,878,344		probably null	Het
Myo18a	T	A	11: 77,818,669	M535K	probably benign	Het
Myocd	T	A	11: 65,204,366	S158C	probably damaging	Het
Naip6	A	T	13: 100,300,069	C649S	probably damaging	Het
Oasl2	T	C	5: 114,897,840	V59A	probably damaging	Het
Obscn	C	A	11: 59,075,005	V2942F	probably benign	Het
Olfr1157	T	A	2: 87,962,575	T106S	probably benign	Het
Olfr517	T	A	7: 108,868,345	T270S	probably benign	Het
Osbpl6	A	G	2: 76,524,094	T18A	probably benign	Het
Pcf11	A	T	7: 92,661,798	D327E	probably benign	Het
Per3	G	T	4: 151,012,681	Q796K	probably benign	Het
Pex5l	T	C	3: 33,005,942	T227A	probably benign	Het
Phf11b	G	T	14: 59,331,255	P70T	probably benign	Het
Pkd1l1	T	G	11: 8,854,390	I2184L		Het
Polr3a	A	T	14: 24,452,221	M1288K	probably damaging	Het
Pth1r	T	A	9: 110,744,779	R3S	probably benign	Het
Ptprk	C	A	10: 28,493,151	Y706*	probably null	Het
Rmi2	C	T	16: 10,886,119	T108I	probably benign	Het
Rrbp1	T	C	2: 143,957,559	N1076S	probably benign	Het
Setd3	A	C	12: 108,108,555		probably null	Het
Slc4a1	A	G	11: 102,357,089	Y360H	probably benign	Het
Sox21	A	G	14: 118,235,581	S19P	possibly damaging	Het
Stx18	T	A	5: 38,092,572	N76K	possibly damaging	Het
Sv2c	T	C	13: 95,985,958	T437A	probably benign	Het
Trrap	G	A	5: 144,840,520	V3043M	probably damaging	Het
Vps50	T	A	6: 3,600,348	S936T	probably benign	Het

Other mutations in Epha8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Epha8	APN	4	136945810	missense	probably damaging	1.00
IGL00960:Epha8	APN	4	136951839	splice site	probably null
IGL01124:Epha8	APN	4	136936083	missense	probably damaging	1.00
IGL01550:Epha8	APN	4	136931740	missense	possibly damaging	0.87
IGL01807:Epha8	APN	4	136931682	missense	probably benign	0.08
IGL01844:Epha8	APN	4	136931049	makesense	probably null
IGL02167:Epha8	APN	4	136931094	missense	probably damaging	1.00
R0255:Epha8	UTSW	4	136940286	missense	probably damaging	0.99
R0445:Epha8	UTSW	4	136932400	missense	probably damaging	1.00
R1757:Epha8	UTSW	4	136931478	splice site	probably null
R1911:Epha8	UTSW	4	136936314	missense	probably damaging	1.00
R1936:Epha8	UTSW	4	136940243	missense	probably benign	0.08
R2291:Epha8	UTSW	4	136933347	missense	probably damaging	1.00
R2359:Epha8	UTSW	4	136946032	missense	probably damaging	1.00
R2372:Epha8	UTSW	4	136933010	missense	probably damaging	1.00
R4581:Epha8	UTSW	4	136933464	missense	probably damaging	1.00
R4747:Epha8	UTSW	4	136938695	frame shift	probably null
R4784:Epha8	UTSW	4	136933322	missense	probably damaging	1.00
R5156:Epha8	UTSW	4	136938726	missense	probably benign	0.14
R5164:Epha8	UTSW	4	136945672	missense	possibly damaging	0.93
R5335:Epha8	UTSW	4	136931935	missense	probably damaging	1.00
R5480:Epha8	UTSW	4	136935130	missense	probably benign
R5552:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R5830:Epha8	UTSW	4	136936390	nonsense	probably null
R6017:Epha8	UTSW	4	136931743	missense	probably damaging	1.00
R6450:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R6798:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R6799:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R7060:Epha8	UTSW	4	136931158	missense	probably damaging	1.00
R7297:Epha8	UTSW	4	136945913	missense	probably damaging	1.00
R7344:Epha8	UTSW	4	136934538	missense	probably benign	0.14
R7467:Epha8	UTSW	4	136931088	missense	possibly damaging	0.90
R7563:Epha8	UTSW	4	136938789	missense	possibly damaging	0.77
R7826:Epha8	UTSW	4	136936187	missense	probably benign	0.09
R7845:Epha8	UTSW	4	136936401	missense	probably benign	0.04
R7863:Epha8	UTSW	4	136933655	missense	probably damaging	1.00
R7904:Epha8	UTSW	4	136931739	missense	possibly damaging	0.95
R7918:Epha8	UTSW	4	136934566	missense	probably benign	0.12
R8177:Epha8	UTSW	4	136945663	missense	probably benign	0.00
R8244:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8266:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8268:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8269:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8289:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8290:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8294:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8295:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8299:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8445:Epha8	UTSW	4	136932289	missense	probably benign	0.13
R8889:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8892:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8928:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8965:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8983:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8984:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8988:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9081:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9231:Epha8	UTSW	4	136945915	missense	probably damaging	1.00
R9262:Epha8	UTSW	4	136931684	missense	probably benign
R9370:Epha8	UTSW	4	136946200	missense	possibly damaging	0.94
R9466:Epha8	UTSW	4	136935103	missense	probably benign
R9478:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9546:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9547:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9550:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9624:Epha8	UTSW	4	136931754	missense	probably damaging	1.00
R9686:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9687:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9690:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9744:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9763:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9794:Epha8	UTSW	4	136938724	missense	probably benign	0.16
RF025:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
RF054:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
Z1176:Epha8	UTSW	4	136938696	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGATGACTGCCTCTGTGTTC -3'
(R):5'- CATCACCTACAACGCAGTGTG -3'

Sequencing Primer
(F):5'- CAGACTGAGTTCTGCTTTCCTATAGG -3'
(R):5'- CAACGCAGTGTGCCGCC -3'

Posted On

2022-08-09