Incidental Mutation 'R9585:Sv2c'
ID 722768
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96122466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: T437A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: T437A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: T437A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: T437A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,199,993 (GRCm39) D533V possibly damaging Het
4933411K16Rik A G 19: 42,041,352 (GRCm39) E161G probably benign Het
Abca12 A G 1: 71,342,745 (GRCm39) S912P probably damaging Het
Abca3 G A 17: 24,619,486 (GRCm39) M1196I probably benign Het
Adprs A T 4: 126,211,786 (GRCm39) D175E probably benign Het
Asrgl1 A G 19: 9,090,398 (GRCm39) L316P probably benign Het
Avl9 T A 6: 56,734,299 (GRCm39) M626K probably damaging Het
Birc6 A G 17: 74,916,265 (GRCm39) N1727S probably damaging Het
Casp14 G A 10: 78,549,194 (GRCm39) R251W probably damaging Het
Cfap69 A G 5: 5,631,269 (GRCm39) I919T possibly damaging Het
Cibar2 T C 8: 120,901,450 (GRCm39) E85G probably null Het
Cps1 T A 1: 67,195,341 (GRCm39) M254K probably damaging Het
Ctc1 A G 11: 68,925,490 (GRCm39) E1009G probably damaging Het
Ddx25 A T 9: 35,455,009 (GRCm39) Y426* probably null Het
Dok3 A G 13: 55,672,057 (GRCm39) F207S probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Fcrla A T 1: 170,749,868 (GRCm39) M1K probably null Het
Heatr4 A T 12: 84,014,472 (GRCm39) S588R probably damaging Het
Iglv3 A G 16: 19,059,960 (GRCm39) *123Q probably null Het
Igsf9b T C 9: 27,233,532 (GRCm39) I344T probably damaging Het
Il18 T C 9: 50,490,661 (GRCm39) S99P probably damaging Het
Krt36 G A 11: 99,994,892 (GRCm39) L227F probably damaging Het
Lrriq1 A G 10: 103,051,250 (GRCm39) S501P probably benign Het
Lvrn T C 18: 47,011,411 (GRCm39) probably null Het
Myo18a T A 11: 77,709,495 (GRCm39) M535K probably benign Het
Myocd T A 11: 65,095,192 (GRCm39) S158C probably damaging Het
Naip6 A T 13: 100,436,577 (GRCm39) C649S probably damaging Het
Oasl2 T C 5: 115,035,901 (GRCm39) V59A probably damaging Het
Obscn C A 11: 58,965,831 (GRCm39) V2942F probably benign Het
Or10a49 T A 7: 108,467,552 (GRCm39) T270S probably benign Het
Or5l14 T A 2: 87,792,919 (GRCm39) T106S probably benign Het
Osbpl6 A G 2: 76,354,438 (GRCm39) T18A probably benign Het
Pcf11 A T 7: 92,311,006 (GRCm39) D327E probably benign Het
Per3 G T 4: 151,097,138 (GRCm39) Q796K probably benign Het
Pex5l T C 3: 33,060,091 (GRCm39) T227A probably benign Het
Phf11b G T 14: 59,568,704 (GRCm39) P70T probably benign Het
Pkd1l1 T G 11: 8,804,390 (GRCm39) I2184L Het
Polr3a A T 14: 24,502,289 (GRCm39) M1288K probably damaging Het
Pth1r T A 9: 110,573,847 (GRCm39) R3S probably benign Het
Ptprk C A 10: 28,369,147 (GRCm39) Y706* probably null Het
Rmi2 C T 16: 10,703,983 (GRCm39) T108I probably benign Het
Rrbp1 T C 2: 143,799,479 (GRCm39) N1076S probably benign Het
Setd3 A C 12: 108,074,814 (GRCm39) probably null Het
Slc4a1 A G 11: 102,247,915 (GRCm39) Y360H probably benign Het
Sox21 A G 14: 118,472,993 (GRCm39) S19P possibly damaging Het
Speer4a2 T C 5: 26,291,542 (GRCm39) H88R possibly damaging Het
Stx18 T A 5: 38,249,916 (GRCm39) N76K possibly damaging Het
Trrap G A 5: 144,777,330 (GRCm39) V3043M probably damaging Het
Vps50 T A 6: 3,600,348 (GRCm39) S936T probably benign Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCGGAATTCTAGCAAGTTAG -3'
(R):5'- TCCGCATTGGCTTTTCAGAAAG -3'

Sequencing Primer
(F):5'- CTAGCAAGTTAGCAGAATTGAGTC -3'
(R):5'- CTCTAGCACACATGAGGTTCTAGG -3'
Posted On 2022-08-09