Incidental Mutation 'R9585:Polr3a'
ID 722770
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24452221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1288 (M1288K)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: M1288K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: M1288K

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,406,344 D533V possibly damaging Het
4933411K16Rik A G 19: 42,052,913 E161G probably benign Het
Abca12 A G 1: 71,303,586 S912P probably damaging Het
Abca3 G A 17: 24,400,512 M1196I probably benign Het
Adprhl2 A T 4: 126,317,993 D175E probably benign Het
Asrgl1 A G 19: 9,113,034 L316P probably benign Het
Avl9 T A 6: 56,757,314 M626K probably damaging Het
Birc6 A G 17: 74,609,270 N1727S probably damaging Het
Casp14 G A 10: 78,713,360 R251W probably damaging Het
Cfap69 A G 5: 5,581,269 I919T possibly damaging Het
Cps1 T A 1: 67,156,182 M254K probably damaging Het
Ctc1 A G 11: 69,034,664 E1009G probably damaging Het
Ddx25 A T 9: 35,543,713 Y426* probably null Het
Dok3 A G 13: 55,524,244 F207S probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fam92b T C 8: 120,174,711 E85G probably null Het
Fcrla A T 1: 170,922,299 M1K probably null Het
Gm10471 T C 5: 26,086,544 H88R possibly damaging Het
Heatr4 A T 12: 83,967,698 S588R probably damaging Het
Iglv3 A G 16: 19,241,210 *123Q probably null Het
Igsf9b T C 9: 27,322,236 I344T probably damaging Het
Il18 T C 9: 50,579,361 S99P probably damaging Het
Krt36 G A 11: 100,104,066 L227F probably damaging Het
Lrriq1 A G 10: 103,215,389 S501P probably benign Het
Lvrn T C 18: 46,878,344 probably null Het
Myo18a T A 11: 77,818,669 M535K probably benign Het
Myocd T A 11: 65,204,366 S158C probably damaging Het
Naip6 A T 13: 100,300,069 C649S probably damaging Het
Oasl2 T C 5: 114,897,840 V59A probably damaging Het
Obscn C A 11: 59,075,005 V2942F probably benign Het
Olfr1157 T A 2: 87,962,575 T106S probably benign Het
Olfr517 T A 7: 108,868,345 T270S probably benign Het
Osbpl6 A G 2: 76,524,094 T18A probably benign Het
Pcf11 A T 7: 92,661,798 D327E probably benign Het
Per3 G T 4: 151,012,681 Q796K probably benign Het
Pex5l T C 3: 33,005,942 T227A probably benign Het
Phf11b G T 14: 59,331,255 P70T probably benign Het
Pkd1l1 T G 11: 8,854,390 I2184L Het
Pth1r T A 9: 110,744,779 R3S probably benign Het
Ptprk C A 10: 28,493,151 Y706* probably null Het
Rmi2 C T 16: 10,886,119 T108I probably benign Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Setd3 A C 12: 108,108,555 probably null Het
Slc4a1 A G 11: 102,357,089 Y360H probably benign Het
Sox21 A G 14: 118,235,581 S19P possibly damaging Het
Stx18 T A 5: 38,092,572 N76K possibly damaging Het
Sv2c T C 13: 95,985,958 T437A probably benign Het
Trrap G A 5: 144,840,520 V3043M probably damaging Het
Vps50 T A 6: 3,600,348 S936T probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8753:Polr3a UTSW 14 24463634 nonsense probably null
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9025:Polr3a UTSW 14 24469411 missense probably damaging 1.00
R9139:Polr3a UTSW 14 24469348 missense probably damaging 1.00
R9264:Polr3a UTSW 14 24470831 missense probably benign
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9526:Polr3a UTSW 14 24453245 missense probably benign 0.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCACACTGAAGGCTTTC -3'
(R):5'- TTGCTGACCCCGACATTTG -3'

Sequencing Primer
(F):5'- CCACACTGAAGGCTTTCTGGTG -3'
(R):5'- CATAGCAATCTGTTGTGGGAAATG -3'
Posted On 2022-08-09