Mutagenetix > Incidental Mutation

Incidental Mutation 'R9586:Chrm3'

722806

Institutional Source

Beutler Lab

Gene Symbol

Chrm3

Ensembl Gene

ENSMUSG00000046159

Gene Name

cholinergic receptor, muscarinic 3, cardiac

Synonyms

muscarinic acetylcholine receptor 3, Chrm-3, M3R

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R9586 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9875486-10360847 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9877444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 519 (C519S)

Ref Sequence

ENSEMBL: ENSMUSP00000140131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]

AlphaFold

Q9ERZ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000063093
AA Change: C519S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: C519S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	75	265	8.9e-7	PFAM
Pfam:7TM_GPCR_Srsx	78	270	6e-11	PFAM
Pfam:7tm_1	84	543	6.9e-82	PFAM
low complexity region	564	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187510
AA Change: C519S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: C519S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	75	265	8.5e-7	PFAM
Pfam:7TM_GPCR_Srsx	78	270	6e-11	PFAM
Pfam:7tm_1	84	543	2.6e-88	PFAM
low complexity region	564	576	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl6ip5	C	T	6: 97,229,611	A84V	possibly damaging	Het
Cep170	G	A	1: 176,735,897	P716L	possibly damaging	Het
Dnase1l3	A	T	14: 7,967,796	V299D	possibly damaging	Het
Dync1h1	T	C	12: 110,616,541	L386P	probably damaging	Het
Elmo3	A	G	8: 105,308,128	Y382C	probably damaging	Het
Eprs	T	C	1: 185,407,549	L945P		Het
Fam196a	T	C	7: 134,918,451	T117A	probably damaging	Het
Fstl4	A	T	11: 53,186,902	I829L	probably benign	Het
Gm36210	T	A	7: 4,906,325	R45*	probably null	Het
Homer2	C	T	7: 81,610,365	R318Q	probably benign	Het
Ice2	G	A	9: 69,407,196	E76K	probably damaging	Het
Ifi203	T	A	1: 173,927,057	R703*	probably null	Het
Lonp1	G	A	17: 56,617,839	R523C	probably damaging	Het
Myh10	G	A	11: 68,812,994	V1881I	possibly damaging	Het
Nfe2	T	C	15: 103,248,817	D249G	probably damaging	Het
Nvl	A	T	1: 181,105,070		probably null	Het
Oog3	A	T	4: 144,158,396	C323*	probably null	Het
Ovgp1	A	G	3: 105,973,822	R3G	probably damaging	Het
Pex1	A	G	5: 3,626,047	I838M	probably damaging	Het
Rps6kc1	C	A	1: 190,782,577	M1006I	probably benign	Het
Rpusd1	A	G	17: 25,728,318	T37A	probably damaging	Het
Sema6d	C	A	2: 124,654,176	R47S	probably damaging	Het
Serpini2	G	A	3: 75,259,584	T122I	probably benign	Het
Slc10a7	A	G	8: 78,729,637	I289M	probably damaging	Het
Slc25a37	G	T	14: 69,244,972	N293K	probably benign	Het
Sspo	G	A	6: 48,481,105	A3281T	probably benign	Het
Stard13	A	T	5: 151,062,367	N559K	possibly damaging	Het
Tmem87b	T	A	2: 128,818,340	M1K	probably null	Het
Vmn1r199	C	T	13: 22,383,546	R337C	probably benign	Het
Vmn1r55	T	A	7: 5,146,771	N218Y	probably benign	Het
Vmn2r41	T	G	7: 8,138,743	Q574P		Het
Vmn2r45	T	C	7: 8,483,051	N413D	probably benign	Het
Wdr33	T	C	18: 31,833,616	S170P	probably damaging	Het
Zfp385a	A	T	15: 103,333,153	I20N	probably damaging	Het
Zfp493	A	G	13: 67,783,898	S39G	possibly damaging	Het

Other mutations in Chrm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01608:Chrm3	APN	13	9878598	missense	possibly damaging	0.80
IGL02266:Chrm3	APN	13	9877278	missense	probably damaging	0.99
IGL02701:Chrm3	APN	13	9878464	nonsense	probably null
IGL03085:Chrm3	APN	13	9877534	missense	probably damaging	1.00
IGL03213:Chrm3	APN	13	9878184	missense	probably benign	0.22
R0147:Chrm3	UTSW	13	9878744	missense	probably damaging	1.00
R0408:Chrm3	UTSW	13	9877933	missense	probably benign	0.10
R0544:Chrm3	UTSW	13	9877579	missense	probably damaging	0.99
R1557:Chrm3	UTSW	13	9878314	missense	possibly damaging	0.82
R1647:Chrm3	UTSW	13	9878425	missense	probably damaging	1.00
R1697:Chrm3	UTSW	13	9878758	missense	probably damaging	1.00
R1791:Chrm3	UTSW	13	9877416	missense	probably damaging	1.00
R1866:Chrm3	UTSW	13	9878481	missense	probably damaging	1.00
R2049:Chrm3	UTSW	13	9878335	missense	probably damaging	1.00
R2909:Chrm3	UTSW	13	9877997	missense	probably benign	0.43
R4212:Chrm3	UTSW	13	9877755	missense	probably benign	0.01
R4422:Chrm3	UTSW	13	9878555	nonsense	probably null
R4790:Chrm3	UTSW	13	9877662	missense	probably benign	0.10
R4934:Chrm3	UTSW	13	9877414	missense	probably damaging	1.00
R5353:Chrm3	UTSW	13	9878557	missense	probably damaging	1.00
R5623:Chrm3	UTSW	13	9877387	missense	possibly damaging	0.92
R6154:Chrm3	UTSW	13	9878440	missense	possibly damaging	0.88
R6416:Chrm3	UTSW	13	9877662	missense	probably benign
R6693:Chrm3	UTSW	13	9877422	missense	probably benign	0.27
R7135:Chrm3	UTSW	13	9877801	missense	probably benign	0.00
R7297:Chrm3	UTSW	13	9877833	missense	probably benign	0.01
R7423:Chrm3	UTSW	13	9878809	missense	probably benign
R7591:Chrm3	UTSW	13	9877313	nonsense	probably null
R8353:Chrm3	UTSW	13	9877231	makesense	probably null
R8355:Chrm3	UTSW	13	9878610	missense	probably damaging	1.00
R8446:Chrm3	UTSW	13	9878302	missense	probably damaging	0.99
R8453:Chrm3	UTSW	13	9877231	makesense	probably null
R9227:Chrm3	UTSW	13	9878443	missense	probably benign	0.00
R9230:Chrm3	UTSW	13	9878443	missense	probably benign	0.00
R9336:Chrm3	UTSW	13	9878616	missense	probably damaging	1.00
R9462:Chrm3	UTSW	13	9877401	missense
R9537:Chrm3	UTSW	13	9877426	missense	probably damaging	1.00
X0066:Chrm3	UTSW	13	9877720	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TAAACCCCTTTTCTACAAGGCC -3'
(R):5'- GCTGGCTAAGAGGTTTGCTC -3'

Sequencing Primer
(F):5'- TCAGGCACTCGCTTGTGAAAAATG -3'
(R):5'- AGGTTTGCTCTCAAGACCAG -3'

Posted On

2022-08-09