Incidental Mutation 'R9588:Ano3'
ID 722871
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110697997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 491 (K491E)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: K491E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: K491E

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,626,408 F153L possibly damaging Het
Arhgap21 C A 2: 20,854,127 C1252F possibly damaging Het
Bcat1 T C 6: 145,004,400 N424S probably benign Het
Ccdc61 A G 7: 18,910,341 probably benign Het
Cecr2 T C 6: 120,756,809 S586P possibly damaging Het
Chd3 A G 11: 69,350,220 C1516R probably damaging Het
Cops5 C A 1: 10,037,997 R5L unknown Het
Cpne2 C A 8: 94,560,153 P369Q possibly damaging Het
Cyp3a25 G T 5: 145,984,889 Q412K probably benign Het
Dbn1 A G 13: 55,474,972 V612A probably benign Het
Dnah17 T C 11: 118,121,957 D426G probably benign Het
Dolpp1 T A 2: 30,392,503 Y23N probably damaging Het
Egf T C 3: 129,717,968 M517V probably benign Het
Fbxw27 ATGT AT 9: 109,773,254 probably null Het
Foxc1 A T 13: 31,808,604 H466L unknown Het
Hsf2bp A G 17: 32,022,836 L78P probably damaging Het
Ikbkb G A 8: 22,661,394 A738V unknown Het
Itgb8 G T 12: 119,177,019 N374K probably benign Het
Kif16b T A 2: 142,711,884 Q998L possibly damaging Het
Krtap11-1 A C 16: 89,571,174 probably benign Het
Lamp3 T A 16: 19,676,082 probably null Het
Lrrc43 A T 5: 123,503,244 H497L probably damaging Het
Mmp1a C T 9: 7,467,224 T267I probably benign Het
Mroh2b T A 15: 4,948,648 D1299E probably benign Het
Ndst4 A C 3: 125,683,159 H11P probably damaging Het
Oas1c A G 5: 120,808,137 F99L probably benign Het
Olfr1138 G A 2: 87,738,300 T8I probably benign Het
Olfr292 T A 7: 86,694,740 C95S probably damaging Het
Olfr339 G T 2: 36,421,772 A125S probably damaging Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pcdhga3 A G 18: 37,675,511 D339G probably damaging Het
Pcsk1 A T 13: 75,110,920 N271I probably damaging Het
Pdilt A T 7: 119,501,647 D160E probably benign Het
Psma4 A T 9: 54,954,961 Q123L probably damaging Het
Selenbp2 A T 3: 94,698,061 I127F possibly damaging Het
Setd5 A G 6: 113,144,064 N1078S probably damaging Het
Sorl1 A C 9: 42,081,809 Y306* probably null Het
Spata17 T C 1: 187,117,274 K255E possibly damaging Het
Surf4 C A 2: 26,933,610 probably benign Het
Tbc1d16 G T 11: 119,210,509 H58Q probably damaging Het
Tfdp2 A G 9: 96,287,610 T5A probably damaging Het
Thsd7b T G 1: 130,180,486 C1313G probably damaging Het
Trmt44 A T 5: 35,569,912 C320S probably damaging Het
Unc119b G A 5: 115,134,768 T48M probably benign Het
Vit T A 17: 78,622,650 I348N probably damaging Het
Vmn1r184 T A 7: 26,266,922 M31K probably null Het
Vmn2r81 A G 10: 79,293,371 T699A possibly damaging Het
Xrn1 A G 9: 96,038,703 T1339A probably benign Het
Zfp827 T A 8: 79,178,975 H860Q probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGTAAGGATGAGAGTCTTCTTC -3'
(R):5'- CTTCCCTCAGGTCTTGGATG -3'

Sequencing Primer
(F):5'- CTAGTTTGATGTTACTGCATTGAGC -3'
(R):5'- CCCTCAGGTCTTGGATGTATAGC -3'
Posted On 2022-08-09