Incidental Mutation 'R9588:Cyp3a25'
ID 722881
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Name cytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 145977194-146009618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 145984889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 412 (Q412K)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
AlphaFold O09158
Predicted Effect probably benign
Transcript: ENSMUST00000068317
AA Change: Q412K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: Q412K

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,626,408 F153L possibly damaging Het
Ano3 T C 2: 110,697,997 K491E possibly damaging Het
Arhgap21 C A 2: 20,854,127 C1252F possibly damaging Het
Bcat1 T C 6: 145,004,400 N424S probably benign Het
Ccdc61 A G 7: 18,910,341 probably benign Het
Cecr2 T C 6: 120,756,809 S586P possibly damaging Het
Chd3 A G 11: 69,350,220 C1516R probably damaging Het
Cops5 C A 1: 10,037,997 R5L unknown Het
Cpne2 C A 8: 94,560,153 P369Q possibly damaging Het
Dbn1 A G 13: 55,474,972 V612A probably benign Het
Dnah17 T C 11: 118,121,957 D426G probably benign Het
Dolpp1 T A 2: 30,392,503 Y23N probably damaging Het
Egf T C 3: 129,717,968 M517V probably benign Het
Fbxw27 ATGT AT 9: 109,773,254 probably null Het
Foxc1 A T 13: 31,808,604 H466L unknown Het
Hsf2bp A G 17: 32,022,836 L78P probably damaging Het
Ikbkb G A 8: 22,661,394 A738V unknown Het
Itgb8 G T 12: 119,177,019 N374K probably benign Het
Kif16b T A 2: 142,711,884 Q998L possibly damaging Het
Krtap11-1 A C 16: 89,571,174 probably benign Het
Lamp3 T A 16: 19,676,082 probably null Het
Lrrc43 A T 5: 123,503,244 H497L probably damaging Het
Mmp1a C T 9: 7,467,224 T267I probably benign Het
Mroh2b T A 15: 4,948,648 D1299E probably benign Het
Ndst4 A C 3: 125,683,159 H11P probably damaging Het
Oas1c A G 5: 120,808,137 F99L probably benign Het
Olfr1138 G A 2: 87,738,300 T8I probably benign Het
Olfr292 T A 7: 86,694,740 C95S probably damaging Het
Olfr339 G T 2: 36,421,772 A125S probably damaging Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pcdhga3 A G 18: 37,675,511 D339G probably damaging Het
Pcsk1 A T 13: 75,110,920 N271I probably damaging Het
Pdilt A T 7: 119,501,647 D160E probably benign Het
Psma4 A T 9: 54,954,961 Q123L probably damaging Het
Selenbp2 A T 3: 94,698,061 I127F possibly damaging Het
Setd5 A G 6: 113,144,064 N1078S probably damaging Het
Sorl1 A C 9: 42,081,809 Y306* probably null Het
Spata17 T C 1: 187,117,274 K255E possibly damaging Het
Surf4 C A 2: 26,933,610 probably benign Het
Tbc1d16 G T 11: 119,210,509 H58Q probably damaging Het
Tfdp2 A G 9: 96,287,610 T5A probably damaging Het
Thsd7b T G 1: 130,180,486 C1313G probably damaging Het
Trmt44 A T 5: 35,569,912 C320S probably damaging Het
Unc119b G A 5: 115,134,768 T48M probably benign Het
Vit T A 17: 78,622,650 I348N probably damaging Het
Vmn1r184 T A 7: 26,266,922 M31K probably null Het
Vmn2r81 A G 10: 79,293,371 T699A possibly damaging Het
Xrn1 A G 9: 96,038,703 T1339A probably benign Het
Zfp827 T A 8: 79,178,975 H860Q probably damaging Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
R7055:Cyp3a25 UTSW 5 145992991 missense probably benign 0.00
R7140:Cyp3a25 UTSW 5 146003045 missense probably benign
R7189:Cyp3a25 UTSW 5 146003060 missense probably benign 0.37
R7201:Cyp3a25 UTSW 5 145991447 missense probably benign 0.22
R7201:Cyp3a25 UTSW 5 146003058 missense probably benign 0.00
R7332:Cyp3a25 UTSW 5 145993007 missense probably damaging 1.00
R7404:Cyp3a25 UTSW 5 145986825 missense probably damaging 1.00
R7548:Cyp3a25 UTSW 5 145986925 missense probably damaging 0.98
R7607:Cyp3a25 UTSW 5 145984981 missense possibly damaging 0.87
R8022:Cyp3a25 UTSW 5 145977668 missense probably benign 0.33
R8266:Cyp3a25 UTSW 5 145992986 missense probably damaging 1.00
R8894:Cyp3a25 UTSW 5 145994860 splice site probably benign
R9249:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R9691:Cyp3a25 UTSW 5 145994922 missense probably benign 0.41
R9694:Cyp3a25 UTSW 5 145986875 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCACACCTTTTCTAAAAGTAC -3'
(R):5'- CATGGAGTACCTGGACATGG -3'

Sequencing Primer
(F):5'- GTACATCCCTCATAAGAGTGCC -3'
(R):5'- ACCTGGACATGGTGGTGAATG -3'
Posted On 2022-08-09