Incidental Mutation 'R9588:Setd5'
ID 722882
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene Name SET domain containing 5
Synonyms 2900045N06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113077365-113153435 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113144064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1078 (N1078S)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
AlphaFold Q5XJV7
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: N1059S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: N1059S

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: N1078S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: N1078S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: N1078S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: N1078S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,626,408 F153L possibly damaging Het
Ano3 T C 2: 110,697,997 K491E possibly damaging Het
Arhgap21 C A 2: 20,854,127 C1252F possibly damaging Het
Bcat1 T C 6: 145,004,400 N424S probably benign Het
Ccdc61 A G 7: 18,910,341 probably benign Het
Cecr2 T C 6: 120,756,809 S586P possibly damaging Het
Chd3 A G 11: 69,350,220 C1516R probably damaging Het
Cops5 C A 1: 10,037,997 R5L unknown Het
Cpne2 C A 8: 94,560,153 P369Q possibly damaging Het
Cyp3a25 G T 5: 145,984,889 Q412K probably benign Het
Dbn1 A G 13: 55,474,972 V612A probably benign Het
Dnah17 T C 11: 118,121,957 D426G probably benign Het
Dolpp1 T A 2: 30,392,503 Y23N probably damaging Het
Egf T C 3: 129,717,968 M517V probably benign Het
Fbxw27 ATGT AT 9: 109,773,254 probably null Het
Foxc1 A T 13: 31,808,604 H466L unknown Het
Hsf2bp A G 17: 32,022,836 L78P probably damaging Het
Ikbkb G A 8: 22,661,394 A738V unknown Het
Itgb8 G T 12: 119,177,019 N374K probably benign Het
Kif16b T A 2: 142,711,884 Q998L possibly damaging Het
Krtap11-1 A C 16: 89,571,174 probably benign Het
Lamp3 T A 16: 19,676,082 probably null Het
Lrrc43 A T 5: 123,503,244 H497L probably damaging Het
Mmp1a C T 9: 7,467,224 T267I probably benign Het
Mroh2b T A 15: 4,948,648 D1299E probably benign Het
Ndst4 A C 3: 125,683,159 H11P probably damaging Het
Oas1c A G 5: 120,808,137 F99L probably benign Het
Olfr1138 G A 2: 87,738,300 T8I probably benign Het
Olfr292 T A 7: 86,694,740 C95S probably damaging Het
Olfr339 G T 2: 36,421,772 A125S probably damaging Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pcdhga3 A G 18: 37,675,511 D339G probably damaging Het
Pcsk1 A T 13: 75,110,920 N271I probably damaging Het
Pdilt A T 7: 119,501,647 D160E probably benign Het
Psma4 A T 9: 54,954,961 Q123L probably damaging Het
Selenbp2 A T 3: 94,698,061 I127F possibly damaging Het
Sorl1 A C 9: 42,081,809 Y306* probably null Het
Spata17 T C 1: 187,117,274 K255E possibly damaging Het
Surf4 C A 2: 26,933,610 probably benign Het
Tbc1d16 G T 11: 119,210,509 H58Q probably damaging Het
Tfdp2 A G 9: 96,287,610 T5A probably damaging Het
Thsd7b T G 1: 130,180,486 C1313G probably damaging Het
Trmt44 A T 5: 35,569,912 C320S probably damaging Het
Unc119b G A 5: 115,134,768 T48M probably benign Het
Vit T A 17: 78,622,650 I348N probably damaging Het
Vmn1r184 T A 7: 26,266,922 M31K probably null Het
Vmn2r81 A G 10: 79,293,371 T699A possibly damaging Het
Xrn1 A G 9: 96,038,703 T1339A probably benign Het
Zfp827 T A 8: 79,178,975 H860Q probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
R8801:Setd5 UTSW 6 113150892 missense possibly damaging 0.95
R8864:Setd5 UTSW 6 113111508 missense probably damaging 1.00
R9227:Setd5 UTSW 6 113121794 missense possibly damaging 0.92
R9522:Setd5 UTSW 6 113115034 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Z1191:Setd5 UTSW 6 113114996 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGACTGTATAGAGGGTCTCCC -3'
(R):5'- TGCCGGCTATTCACAACAC -3'

Sequencing Primer
(F):5'- CTTGGTGGGAGACAGGAAGCC -3'
(R):5'- CGATAACTTGAGTTCAATCCCAGG -3'
Posted On 2022-08-09