Mutagenetix > Incidental Mutation

Incidental Mutation 'R9589:C2cd3'

722932

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9589 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100021440-100119359 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100081756 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1133 (S1133T)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]

AlphaFold

Q52KB6

Predicted Effect

probably benign
Transcript: ENSMUST00000051777
AA Change: S1511T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: S1511T

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098259
AA Change: S1511T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: S1511T

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: S1133T

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120196
AA Change: S280T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: S280T

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg3	A	G	8: 95,760,093 (GRCm39)	D104G	possibly damaging	Het
Ahnak2	G	T	12: 112,746,831 (GRCm39)	D1166E		Het
Ccdc17	A	G	4: 116,454,791 (GRCm39)	Q168R	probably benign	Het
Fn1	A	T	1: 71,668,941 (GRCm39)	I668N	probably damaging	Het
Fyb2	C	A	4: 104,872,833 (GRCm39)	N735K	probably damaging	Het
Gad1	T	C	2: 70,416,284 (GRCm39)	S248P	possibly damaging	Het
Gcnt1	G	A	19: 17,307,422 (GRCm39)	A101V	probably benign	Het
Herc1	T	A	9: 66,372,840 (GRCm39)	M3132K	possibly damaging	Het
Htra3	T	C	5: 35,821,409 (GRCm39)	I323V	probably damaging	Het
Ighv11-2	A	T	12: 114,012,047 (GRCm39)	V56D	probably damaging	Het
Itga8	C	T	2: 12,237,701 (GRCm39)	G340R	probably damaging	Het
Kcnk15	C	T	2: 163,700,127 (GRCm39)	T122M	probably damaging	Het
Kif13a	G	T	13: 46,956,020 (GRCm39)	Q658K	probably benign	Het
Kif13b	T	C	14: 65,013,759 (GRCm39)	I1303T	possibly damaging	Het
Kifc3	A	T	8: 95,861,372 (GRCm39)	S94R	possibly damaging	Het
Lrrc63	A	T	14: 75,322,379 (GRCm39)	F575Y	possibly damaging	Het
Map1a	T	C	2: 121,136,398 (GRCm39)	S2405P	probably damaging	Het
Map2	A	G	1: 66,449,753 (GRCm39)	T159A	probably benign	Het
Mgam	A	T	6: 40,727,519 (GRCm39)	I1315F	probably damaging	Het
Or51a39	T	C	7: 102,363,372 (GRCm39)	T83A	probably damaging	Het
Pah	T	A	10: 87,403,197 (GRCm39)	F191I	probably damaging	Het
Plekhh2	G	A	17: 84,854,918 (GRCm39)	D51N	possibly damaging	Het
Ppp4r2	C	T	6: 100,838,409 (GRCm39)	T109M	probably damaging	Het
Rfx7	T	C	9: 72,525,122 (GRCm39)	S771P	possibly damaging	Het
Sec11a	T	C	7: 80,565,899 (GRCm39)	*171W	probably null	Het
Secisbp2l	C	A	2: 125,589,425 (GRCm39)	V708L	probably benign	Het
Secisbp2l	T	G	2: 125,589,430 (GRCm39)	D706A	probably damaging	Het
Shpk	C	T	11: 73,104,267 (GRCm39)	P139S	possibly damaging	Het
Slc6a18	A	G	13: 73,816,323 (GRCm39)	L352P	possibly damaging	Het
Slitrk3	T	C	3: 72,957,981 (GRCm39)	T264A	probably benign	Het
Smg9	T	G	7: 24,120,246 (GRCm39)	S407A	probably damaging	Het
Stmn4	A	G	14: 66,595,338 (GRCm39)	E121G	probably damaging	Het
Tmem237	G	A	1: 59,159,146 (GRCm39)	P10S	probably benign	Het
Vmn2r73	A	G	7: 85,519,659 (GRCm39)	I433T	probably benign	Het
Zfp28	T	A	7: 6,392,816 (GRCm39)	M164K	probably benign	Het
Zswim8	A	G	14: 20,763,171 (GRCm39)	M357V	probably damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100,040,335 (GRCm39)	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100,104,065 (GRCm39)	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100,092,638 (GRCm39)	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100,076,421 (GRCm39)	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100,023,693 (GRCm39)	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100,068,922 (GRCm39)	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100,076,376 (GRCm39)	unclassified	probably benign
IGL02852:C2cd3	APN	7	100,079,396 (GRCm39)	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100,023,683 (GRCm39)	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0124:C2cd3	UTSW	7	100,118,725 (GRCm39)	missense	probably benign
R0387:C2cd3	UTSW	7	100,071,714 (GRCm39)	splice site	probably benign
R0522:C2cd3	UTSW	7	100,044,429 (GRCm39)	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100,071,888 (GRCm39)	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100,089,397 (GRCm39)	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100,055,284 (GRCm39)	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100,021,704 (GRCm39)	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100,056,232 (GRCm39)	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100,104,700 (GRCm39)	unclassified	probably benign
R2060:C2cd3	UTSW	7	100,104,155 (GRCm39)	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100,062,573 (GRCm39)	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100,044,459 (GRCm39)	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100,085,040 (GRCm39)	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100,081,205 (GRCm39)	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100,103,808 (GRCm39)	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100,090,296 (GRCm39)	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100,081,306 (GRCm39)	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100,023,684 (GRCm39)	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100,021,657 (GRCm39)	unclassified	probably benign
R4705:C2cd3	UTSW	7	100,044,395 (GRCm39)	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100,092,642 (GRCm39)	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100,065,539 (GRCm39)	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100,040,226 (GRCm39)	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100,065,397 (GRCm39)	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100,104,160 (GRCm39)	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100,062,581 (GRCm39)	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100,055,166 (GRCm39)	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100,109,049 (GRCm39)	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100,092,692 (GRCm39)	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100,104,700 (GRCm39)	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100,093,682 (GRCm39)	unclassified	probably benign
R6110:C2cd3	UTSW	7	100,090,283 (GRCm39)	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100,065,635 (GRCm39)	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100,081,298 (GRCm39)	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100,104,505 (GRCm39)	missense	probably benign
R6613:C2cd3	UTSW	7	100,044,448 (GRCm39)	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100,067,747 (GRCm39)	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100,104,553 (GRCm39)	missense	probably benign
R6837:C2cd3	UTSW	7	100,097,953 (GRCm39)	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100,056,134 (GRCm39)	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100,039,448 (GRCm39)	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100,100,826 (GRCm39)	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100,081,299 (GRCm39)	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100,065,388 (GRCm39)	missense
R7174:C2cd3	UTSW	7	100,081,405 (GRCm39)	missense
R7241:C2cd3	UTSW	7	100,056,257 (GRCm39)	missense
R7335:C2cd3	UTSW	7	100,071,810 (GRCm39)	missense
R7357:C2cd3	UTSW	7	100,079,310 (GRCm39)	missense
R7493:C2cd3	UTSW	7	100,076,433 (GRCm39)	missense
R7567:C2cd3	UTSW	7	100,080,022 (GRCm39)	missense
R7573:C2cd3	UTSW	7	100,068,914 (GRCm39)	missense
R7869:C2cd3	UTSW	7	100,118,698 (GRCm39)	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100,109,096 (GRCm39)	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100,067,711 (GRCm39)	missense
R8369:C2cd3	UTSW	7	100,044,465 (GRCm39)	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100,104,487 (GRCm39)	nonsense	probably null
R8753:C2cd3	UTSW	7	100,049,024 (GRCm39)	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100,104,004 (GRCm39)	missense	probably benign
R8905:C2cd3	UTSW	7	100,074,132 (GRCm39)	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100,040,286 (GRCm39)	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100,068,971 (GRCm39)	missense
R9000:C2cd3	UTSW	7	100,065,281 (GRCm39)	missense
R9064:C2cd3	UTSW	7	100,059,608 (GRCm39)	missense
R9072:C2cd3	UTSW	7	100,040,291 (GRCm39)	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100,081,430 (GRCm39)	missense
R9160:C2cd3	UTSW	7	100,075,236 (GRCm39)	missense
R9234:C2cd3	UTSW	7	100,049,012 (GRCm39)	missense
R9258:C2cd3	UTSW	7	100,098,026 (GRCm39)	missense
R9295:C2cd3	UTSW	7	100,081,734 (GRCm39)	missense
R9411:C2cd3	UTSW	7	100,065,704 (GRCm39)	missense
R9420:C2cd3	UTSW	7	100,065,262 (GRCm39)	missense
R9628:C2cd3	UTSW	7	100,097,961 (GRCm39)	missense
R9629:C2cd3	UTSW	7	100,029,249 (GRCm39)	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100,023,662 (GRCm39)	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100,076,458 (GRCm39)	missense
X0002:C2cd3	UTSW	7	100,089,442 (GRCm39)	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CCTCTCAGGAAACCTAAGGAGTC -3'
(R):5'- TCAAGGAGATTCACCCAAGCTC -3'

Sequencing Primer
(F):5'- ACCAGGTCCTGATTACTTTCAAGG -3'
(R):5'- GAGATTCACCCAAGCTCACTGTG -3'

Posted On

2022-08-09