Incidental Mutation 'R9590:C130073F10Rik'
ID 722960
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9590 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101747618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 137 (T137I)
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect probably benign
Transcript: ENSMUST00000051043
AA Change: T137I

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,876,506 (GRCm39) T1087A probably benign Het
Aopep A G 13: 63,208,923 (GRCm39) T347A probably benign Het
Atp8b2 A T 3: 89,865,693 (GRCm39) L69* probably null Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
C9orf72 C T 4: 35,218,557 (GRCm39) G101R Het
Cacna1a C T 8: 85,328,610 (GRCm39) Q1683* probably null Het
Calml4 A G 9: 62,782,810 (GRCm39) Y139C probably benign Het
Cd33 T A 7: 43,179,637 (GRCm39) I264F probably benign Het
Cfi A T 3: 129,642,461 (GRCm39) H105L probably benign Het
Cnr1 G T 4: 33,944,849 (GRCm39) M412I probably benign Het
Cyp2j11 T A 4: 96,195,614 (GRCm39) M361L probably benign Het
Dnase2b A T 3: 146,290,323 (GRCm39) V216D probably benign Het
Eif1 C T 11: 100,210,867 (GRCm39) probably benign Het
Faap100 G A 11: 120,269,545 (GRCm39) probably benign Het
Fkbp10 A T 11: 100,306,785 (GRCm39) Q59L probably damaging Het
Galnt13 G T 2: 54,747,973 (GRCm39) V285F probably benign Het
Gm32742 A G 9: 51,050,461 (GRCm39) F1510S possibly damaging Het
Klhl33 T G 14: 51,130,042 (GRCm39) D224A probably benign Het
Man1a A G 10: 53,784,060 (GRCm39) F607S probably damaging Het
Mcc T C 18: 44,592,977 (GRCm39) N686S possibly damaging Het
Mlip A G 9: 77,045,834 (GRCm39) M882T probably benign Het
Mmp9 T A 2: 164,790,834 (GRCm39) M74K probably benign Het
Nek10 C A 14: 14,853,888 (GRCm38) S358Y probably damaging Het
Or51a7 T C 7: 102,614,553 (GRCm39) L82P probably benign Het
Or5b12b T C 19: 12,861,980 (GRCm39) V245A probably benign Het
Or8g29-ps1 A T 9: 39,201,076 (GRCm39) C37S unknown Het
Padi1 T C 4: 140,544,552 (GRCm39) D547G probably damaging Het
Pcbp4 T C 9: 106,340,400 (GRCm39) S332P possibly damaging Het
Pde2a A G 7: 101,160,757 (GRCm39) I909V probably benign Het
Ppil6 T C 10: 41,366,478 (GRCm39) M1T probably null Het
Proser2 A G 2: 6,105,794 (GRCm39) S257P probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Scn9a A G 2: 66,314,328 (GRCm39) F1797L probably benign Het
Sfmbt1 T C 14: 30,512,727 (GRCm39) L360P probably damaging Het
Tab1 A T 15: 80,040,097 (GRCm39) N306Y probably damaging Het
Tob2 A C 15: 81,735,068 (GRCm39) F300L possibly damaging Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R0621:C130073F10Rik UTSW 4 101,747,992 (GRCm39) missense probably damaging 1.00
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8186:C130073F10Rik UTSW 4 101,748,031 (GRCm39) nonsense probably null
R8353:C130073F10Rik UTSW 4 101,747,881 (GRCm39) splice site probably null
R8857:C130073F10Rik UTSW 4 101,747,555 (GRCm39) missense possibly damaging 0.52
R9559:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACAGATCCCAGGATATCTCAAGG -3'
(R):5'- TGCATGGAGGTTGAGACATG -3'

Sequencing Primer
(F):5'- TCTCAAGGGATCTAACACCTTG -3'
(R):5'- TGGGAGCAAAGCAAATTATACATTGC -3'
Posted On 2022-08-09