Mutagenetix > Incidental Mutation

Incidental Mutation 'R9591:Rgl2'

723020

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R9591 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33932477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 165 (T165I)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047503
AA Change: T165I

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: T165I

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	A	4: 147,945,031	I486N	probably damaging	Het
3110043O21Rik	C	T	4: 35,218,557	G101R		Het
Ablim3	T	C	18: 61,821,913	Y335C	probably benign	Het
Adam24	C	A	8: 40,679,659	D55E	probably benign	Het
Ankrd13d	A	G	19: 4,270,222	*164Q	probably null	Het
Arhgap25	T	C	6: 87,463,120	N515S	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Btbd9	T	C	17: 30,517,248	D297G	probably damaging	Het
C4b	A	T	17: 34,738,955	M584K	probably benign	Het
Ccdc116	T	C	16: 17,142,734	D73G	probably damaging	Het
Cd19	A	G	7: 126,412,124	V296A	probably benign	Het
Cldn19	A	G	4: 119,257,160	T133A	probably benign	Het
Crygn	G	T	5: 24,756,075	H78N	probably damaging	Het
Dhrs11	T	G	11: 84,828,758	N47T	probably benign	Het
Fat3	T	C	9: 16,377,040	S396G	probably benign	Het
Gm3667	T	C	14: 6,873,057	Y139C	probably damaging	Het
Hivep2	A	G	10: 14,143,896	N2137S	probably damaging	Het
Iapp	T	A	6: 142,303,337	C39S	probably damaging	Het
Irs1	T	C	1: 82,288,248	E749G	probably benign	Het
Lpcat1	T	G	13: 73,511,352	V411G	probably damaging	Het
Map3k4	C	A	17: 12,235,908	E1398D	possibly damaging	Het
Muc5b	A	G	7: 141,858,779	T1821A	unknown	Het
Neu1	T	C	17: 34,931,498	L31P	probably benign	Het
Nfam1	T	C	15: 83,016,380	T94A	possibly damaging	Het
Nlrc5	T	G	8: 94,522,681	S1752R	probably damaging	Het
Olfr65	A	T	7: 103,907,263	I272F		Het
Opn1sw	T	A	6: 29,378,927	E242V	probably damaging	Het
Peak1	C	A	9: 56,259,550	V365F	possibly damaging	Het
Rnpepl1	T	C	1: 92,919,587	L632P	probably damaging	Het
Sec1	G	A	7: 45,678,678	T315M		Het
Sipa1l2	A	T	8: 125,492,373	M75K	probably damaging	Het
Smchd1	G	A	17: 71,394,833	H1055Y	probably damaging	Het
Sprr2a3	T	A	3: 92,288,654	C23S	unknown	Het
Tbck	T	A	3: 132,694,434	L82Q	probably benign	Het
Tmprss11a	C	T	5: 86,420,038	V277I	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,659	E565V	possibly damaging	Het
Zfp148	T	A	16: 33,495,367	D230E		Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAAGGTAGACCCTCTCCTC -3'
(R):5'- CATCTAGCAGGGTCAGCTGTTC -3'

Sequencing Primer
(F):5'- TCATCCCCAGGCTGGAAG -3'
(R):5'- TCAGCTGTTCGGCCAAGTG -3'

Posted On

2022-08-09