Incidental Mutation 'R9591:Rgl2'
ID 723020
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R9591 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34151451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 165 (T165I)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: T165I

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 148,029,488 (GRCm39) I486N probably damaging Het
Ablim3 T C 18: 61,954,984 (GRCm39) Y335C probably benign Het
Adam24 C A 8: 41,132,698 (GRCm39) D55E probably benign Het
Ankrd13d A G 19: 4,320,250 (GRCm39) *164Q probably null Het
Arhgap25 T C 6: 87,440,102 (GRCm39) N515S probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Btbd9 T C 17: 30,736,222 (GRCm39) D297G probably damaging Het
C4b A T 17: 34,957,929 (GRCm39) M584K probably benign Het
C9orf72 C T 4: 35,218,557 (GRCm39) G101R Het
Ccdc116 T C 16: 16,960,598 (GRCm39) D73G probably damaging Het
Cd19 A G 7: 126,011,296 (GRCm39) V296A probably benign Het
Cldn19 A G 4: 119,114,357 (GRCm39) T133A probably benign Het
Crygn G T 5: 24,961,073 (GRCm39) H78N probably damaging Het
Dhrs11 T G 11: 84,719,584 (GRCm39) N47T probably benign Het
Fat3 T C 9: 16,288,336 (GRCm39) S396G probably benign Het
Gm3667 T C 14: 18,270,388 (GRCm39) Y139C probably damaging Het
Hivep2 A G 10: 14,019,640 (GRCm39) N2137S probably damaging Het
Iapp T A 6: 142,249,063 (GRCm39) C39S probably damaging Het
Irs1 T C 1: 82,265,969 (GRCm39) E749G probably benign Het
Lpcat1 T G 13: 73,659,471 (GRCm39) V411G probably damaging Het
Map3k4 C A 17: 12,454,795 (GRCm39) E1398D possibly damaging Het
Muc5b A G 7: 141,412,516 (GRCm39) T1821A unknown Het
Neu1 T C 17: 35,150,474 (GRCm39) L31P probably benign Het
Nfam1 T C 15: 82,900,581 (GRCm39) T94A possibly damaging Het
Nlrc5 T G 8: 95,249,309 (GRCm39) S1752R probably damaging Het
Opn1sw T A 6: 29,378,926 (GRCm39) E242V probably damaging Het
Or51b6 A T 7: 103,556,470 (GRCm39) I272F Het
Peak1 C A 9: 56,166,834 (GRCm39) V365F possibly damaging Het
Rnpepl1 T C 1: 92,847,309 (GRCm39) L632P probably damaging Het
Sec1 G A 7: 45,328,102 (GRCm39) T315M Het
Sipa1l2 A T 8: 126,219,112 (GRCm39) M75K probably damaging Het
Smchd1 G A 17: 71,701,828 (GRCm39) H1055Y probably damaging Het
Sprr2a3 T A 3: 92,195,961 (GRCm39) C23S unknown Het
Tbck T A 3: 132,400,195 (GRCm39) L82Q probably benign Het
Tmprss11a C T 5: 86,567,897 (GRCm39) V277I possibly damaging Het
Vmn2r103 A T 17: 20,031,921 (GRCm39) E565V possibly damaging Het
Zfp148 T A 16: 33,315,737 (GRCm39) D230E Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGTAGACCCTCTCCTC -3'
(R):5'- CATCTAGCAGGGTCAGCTGTTC -3'

Sequencing Primer
(F):5'- TCATCCCCAGGCTGGAAG -3'
(R):5'- TCAGCTGTTCGGCCAAGTG -3'
Posted On 2022-08-09