Incidental Mutation 'R9591:C4b'
ID 723021
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement component 4B (Chido blood group)
Synonyms C4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9591 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34728380-34743882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34738955 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 584 (M584K)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: M584K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: M584K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,945,031 I486N probably damaging Het
3110043O21Rik C T 4: 35,218,557 G101R Het
Ablim3 T C 18: 61,821,913 Y335C probably benign Het
Adam24 C A 8: 40,679,659 D55E probably benign Het
Ankrd13d A G 19: 4,270,222 *164Q probably null Het
Arhgap25 T C 6: 87,463,120 N515S probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Btbd9 T C 17: 30,517,248 D297G probably damaging Het
Ccdc116 T C 16: 17,142,734 D73G probably damaging Het
Cd19 A G 7: 126,412,124 V296A probably benign Het
Cldn19 A G 4: 119,257,160 T133A probably benign Het
Crygn G T 5: 24,756,075 H78N probably damaging Het
Dhrs11 T G 11: 84,828,758 N47T probably benign Het
Fat3 T C 9: 16,377,040 S396G probably benign Het
Gm3667 T C 14: 6,873,057 Y139C probably damaging Het
Hivep2 A G 10: 14,143,896 N2137S probably damaging Het
Iapp T A 6: 142,303,337 C39S probably damaging Het
Irs1 T C 1: 82,288,248 E749G probably benign Het
Lpcat1 T G 13: 73,511,352 V411G probably damaging Het
Map3k4 C A 17: 12,235,908 E1398D possibly damaging Het
Muc5b A G 7: 141,858,779 T1821A unknown Het
Neu1 T C 17: 34,931,498 L31P probably benign Het
Nfam1 T C 15: 83,016,380 T94A possibly damaging Het
Nlrc5 T G 8: 94,522,681 S1752R probably damaging Het
Olfr65 A T 7: 103,907,263 I272F Het
Opn1sw T A 6: 29,378,927 E242V probably damaging Het
Peak1 C A 9: 56,259,550 V365F possibly damaging Het
Rgl2 C T 17: 33,932,477 T165I possibly damaging Het
Rnpepl1 T C 1: 92,919,587 L632P probably damaging Het
Sec1 G A 7: 45,678,678 T315M Het
Sipa1l2 A T 8: 125,492,373 M75K probably damaging Het
Smchd1 G A 17: 71,394,833 H1055Y probably damaging Het
Sprr2a3 T A 3: 92,288,654 C23S unknown Het
Tbck T A 3: 132,694,434 L82Q probably benign Het
Tmprss11a C T 5: 86,420,038 V277I possibly damaging Het
Vmn2r103 A T 17: 19,811,659 E565V possibly damaging Het
Zfp148 T A 16: 33,495,367 D230E Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
R8853:C4b UTSW 17 34729905 missense possibly damaging 0.91
R8934:C4b UTSW 17 34732984 missense possibly damaging 0.78
R8944:C4b UTSW 17 34742939 missense probably benign 0.00
R8960:C4b UTSW 17 34733918 missense probably damaging 1.00
R8982:C4b UTSW 17 34734364 critical splice donor site probably null
R9104:C4b UTSW 17 34729259 missense probably benign 0.39
R9114:C4b UTSW 17 34729430 missense probably damaging 0.99
R9348:C4b UTSW 17 34733185 missense probably benign 0.01
R9428:C4b UTSW 17 34730911 missense possibly damaging 0.52
R9533:C4b UTSW 17 34737724 nonsense probably null
R9678:C4b UTSW 17 34741789 critical splice donor site probably null
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAAGTGGAGGAGGAAGAGGA -3'
(R):5'- ATGACAGGCATGCCCTCA -3'

Sequencing Primer
(F):5'- CAAGGCAGAGGCACAGG -3'
(R):5'- ACCCCCACCTGGATTCTGG -3'
Posted On 2022-08-09