Incidental Mutation 'R9593:Myo3b'
ID 723079
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9593 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70245304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 579 (G579R)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: G579R

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: G579R

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: G551R

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: G551R

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,947,941 V1345A probably damaging Het
A130010J15Rik T A 1: 193,174,779 D146E probably benign Het
Acaca C T 11: 84,380,513 Q2058* probably null Het
Adam39 T A 8: 40,826,707 C712S possibly damaging Het
Aipl1 T C 11: 72,030,335 E219G probably benign Het
Ankrd24 A G 10: 81,640,064 R301G unknown Het
Arhgef17 A G 7: 100,882,802 F272L probably damaging Het
B3galt2 T A 1: 143,646,866 Y247N probably damaging Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Cat T C 2: 103,455,088 E503G probably benign Het
Coro1b T A 19: 4,149,498 V52E probably damaging Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dip2c T A 13: 9,654,647 M1344K possibly damaging Het
Dnah5 A G 15: 28,236,628 I367V probably benign Het
Dock2 T C 11: 34,228,607 T1807A probably benign Het
Dusp10 T A 1: 184,074,446 F459I probably damaging Het
Elac1 A T 18: 73,739,018 L302Q probably benign Het
Fam189b T A 3: 89,183,892 S57T probably benign Het
Fdx1l A T 9: 21,067,801 Y165N probably damaging Het
Gabra2 C T 5: 71,008,010 V206I possibly damaging Het
Gabrg1 T C 5: 70,782,465 E108G probably damaging Het
Gm29394 A G 15: 58,069,326 L5P probably benign Het
Gnb1l C T 16: 18,544,164 P101S probably benign Het
Hectd4 C A 5: 121,286,781 S749* probably null Het
Hmcn2 A G 2: 31,354,730 Y733C probably damaging Het
Inafm1 G A 7: 16,273,134 L53F probably damaging Het
Iqgap3 G A 3: 88,104,350 R814H probably damaging Het
Map3k19 A G 1: 127,850,426 C21R probably benign Het
Maz A G 7: 127,025,752 F199L probably damaging Het
Mis18bp1 A G 12: 65,140,854 I825T probably damaging Het
Mpp3 T A 11: 102,016,680 T211S possibly damaging Het
Mtrf1 T C 14: 79,419,224 Y389H probably damaging Het
Nlrp4e T C 7: 23,320,772 V228A probably benign Het
Npepps T A 11: 97,258,353 probably null Het
Ntng1 A G 3: 109,934,908 L183P probably damaging Het
Olfr894 A G 9: 38,219,572 T247A probably benign Het
Pcdha4 A C 18: 36,953,687 I308L probably benign Het
Pear1 G T 3: 87,751,173 Q964K probably benign Het
Plekhg2 A T 7: 28,360,285 D1182E possibly damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Ptpn13 T A 5: 103,527,132 D658E possibly damaging Het
Ptprq T C 10: 107,688,393 Y493C possibly damaging Het
Rnd1 A G 15: 98,672,645 W107R probably damaging Het
Scn5a G A 9: 119,486,773 T1623M probably damaging Het
Sec23b T C 2: 144,568,644 I288T probably benign Het
Slfn14 T A 11: 83,283,907 H86L probably benign Het
Smchd1 G A 17: 71,394,833 H1055Y probably damaging Het
Sox13 G A 1: 133,388,476 P243S probably damaging Het
St3gal6 C A 16: 58,484,773 E109* probably null Het
Tmem2 T C 19: 21,826,089 S829P probably damaging Het
Traf4 T C 11: 78,165,427 D5G possibly damaging Het
Trank1 G T 9: 111,362,297 C458F probably benign Het
Ttc41 T C 10: 86,713,185 F81S probably benign Het
Tulp1 C T 17: 28,353,828 W451* probably null Het
Tyms T C 5: 30,064,112 I171V Het
Vmn2r115 T A 17: 23,359,210 N552K probably damaging Het
Zfp710 T A 7: 80,081,161 S29T possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATCTCAGCCCTTGCAAG -3'
(R):5'- TTTGAAAACTGTCCTGCAAGC -3'

Sequencing Primer
(F):5'- GTATTAGCCTGTGAAGGGA -3'
(R):5'- CTGTCCTGCAAGCTAGAAAAC -3'
Posted On 2022-08-09