Incidental Mutation 'R9593:Trank1'
ID 723103
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9593 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111311739-111395775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 111362297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 458 (C458F)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: C458F

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: C458F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,947,941 V1345A probably damaging Het
A130010J15Rik T A 1: 193,174,779 D146E probably benign Het
Acaca C T 11: 84,380,513 Q2058* probably null Het
Adam39 T A 8: 40,826,707 C712S possibly damaging Het
Aipl1 T C 11: 72,030,335 E219G probably benign Het
Ankrd24 A G 10: 81,640,064 R301G unknown Het
Arhgef17 A G 7: 100,882,802 F272L probably damaging Het
B3galt2 T A 1: 143,646,866 Y247N probably damaging Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Cat T C 2: 103,455,088 E503G probably benign Het
Coro1b T A 19: 4,149,498 V52E probably damaging Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dip2c T A 13: 9,654,647 M1344K possibly damaging Het
Dnah5 A G 15: 28,236,628 I367V probably benign Het
Dock2 T C 11: 34,228,607 T1807A probably benign Het
Dusp10 T A 1: 184,074,446 F459I probably damaging Het
Elac1 A T 18: 73,739,018 L302Q probably benign Het
Fam189b T A 3: 89,183,892 S57T probably benign Het
Fdx1l A T 9: 21,067,801 Y165N probably damaging Het
Gabra2 C T 5: 71,008,010 V206I possibly damaging Het
Gabrg1 T C 5: 70,782,465 E108G probably damaging Het
Gm29394 A G 15: 58,069,326 L5P probably benign Het
Gnb1l C T 16: 18,544,164 P101S probably benign Het
Hectd4 C A 5: 121,286,781 S749* probably null Het
Hmcn2 A G 2: 31,354,730 Y733C probably damaging Het
Inafm1 G A 7: 16,273,134 L53F probably damaging Het
Iqgap3 G A 3: 88,104,350 R814H probably damaging Het
Map3k19 A G 1: 127,850,426 C21R probably benign Het
Maz A G 7: 127,025,752 F199L probably damaging Het
Mis18bp1 A G 12: 65,140,854 I825T probably damaging Het
Mpp3 T A 11: 102,016,680 T211S possibly damaging Het
Mtrf1 T C 14: 79,419,224 Y389H probably damaging Het
Myo3b G A 2: 70,245,304 G579R probably benign Het
Nlrp4e T C 7: 23,320,772 V228A probably benign Het
Npepps T A 11: 97,258,353 probably null Het
Ntng1 A G 3: 109,934,908 L183P probably damaging Het
Olfr894 A G 9: 38,219,572 T247A probably benign Het
Pcdha4 A C 18: 36,953,687 I308L probably benign Het
Pear1 G T 3: 87,751,173 Q964K probably benign Het
Plekhg2 A T 7: 28,360,285 D1182E possibly damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Ptpn13 T A 5: 103,527,132 D658E possibly damaging Het
Ptprq T C 10: 107,688,393 Y493C possibly damaging Het
Rnd1 A G 15: 98,672,645 W107R probably damaging Het
Scn5a G A 9: 119,486,773 T1623M probably damaging Het
Sec23b T C 2: 144,568,644 I288T probably benign Het
Slfn14 T A 11: 83,283,907 H86L probably benign Het
Smchd1 G A 17: 71,394,833 H1055Y probably damaging Het
Sox13 G A 1: 133,388,476 P243S probably damaging Het
St3gal6 C A 16: 58,484,773 E109* probably null Het
Tmem2 T C 19: 21,826,089 S829P probably damaging Het
Traf4 T C 11: 78,165,427 D5G possibly damaging Het
Ttc41 T C 10: 86,713,185 F81S probably benign Het
Tulp1 C T 17: 28,353,828 W451* probably null Het
Tyms T C 5: 30,064,112 I171V Het
Vmn2r115 T A 17: 23,359,210 N552K probably damaging Het
Zfp710 T A 7: 80,081,161 S29T possibly damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
R8829:Trank1 UTSW 9 111347523 missense probably benign
R8838:Trank1 UTSW 9 111364905 missense probably benign 0.03
R8855:Trank1 UTSW 9 111312221 missense unknown
R8929:Trank1 UTSW 9 111378935 missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111362432 missense probably damaging 0.99
R9090:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9114:Trank1 UTSW 9 111333775 missense probably damaging 1.00
R9133:Trank1 UTSW 9 111391702 missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111392511 missense probably benign 0.00
R9178:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R9271:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9314:Trank1 UTSW 9 111365981 missense probably damaging 1.00
R9373:Trank1 UTSW 9 111365191 missense probably benign 0.25
R9380:Trank1 UTSW 9 111392670 missense probably benign 0.07
R9435:Trank1 UTSW 9 111364822 missense probably benign 0.04
R9501:Trank1 UTSW 9 111347875 missense probably benign 0.00
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CCTTCATGGCTAAGTAACTTGTCC -3'
(R):5'- TCAGAAGCTGGGTCTTCCTC -3'

Sequencing Primer
(F):5'- CCTTCATAGAACTTACACAGTACTTC -3'
(R):5'- TTCCTCTGGTCCCAGGAG -3'
Posted On 2022-08-09