Incidental Mutation 'R9593:Mtrf1'
ID 723118
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R9593 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 79397772-79423587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79419224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 389 (Y389H)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
AlphaFold Q8K126
Predicted Effect probably damaging
Transcript: ENSMUST00000022600
AA Change: Y389H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: Y389H

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,947,941 V1345A probably damaging Het
A130010J15Rik T A 1: 193,174,779 D146E probably benign Het
Acaca C T 11: 84,380,513 Q2058* probably null Het
Adam39 T A 8: 40,826,707 C712S possibly damaging Het
Aipl1 T C 11: 72,030,335 E219G probably benign Het
Ankrd24 A G 10: 81,640,064 R301G unknown Het
Arhgef17 A G 7: 100,882,802 F272L probably damaging Het
B3galt2 T A 1: 143,646,866 Y247N probably damaging Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Cat T C 2: 103,455,088 E503G probably benign Het
Coro1b T A 19: 4,149,498 V52E probably damaging Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dip2c T A 13: 9,654,647 M1344K possibly damaging Het
Dnah5 A G 15: 28,236,628 I367V probably benign Het
Dock2 T C 11: 34,228,607 T1807A probably benign Het
Dusp10 T A 1: 184,074,446 F459I probably damaging Het
Elac1 A T 18: 73,739,018 L302Q probably benign Het
Fam189b T A 3: 89,183,892 S57T probably benign Het
Fdx1l A T 9: 21,067,801 Y165N probably damaging Het
Gabra2 C T 5: 71,008,010 V206I possibly damaging Het
Gabrg1 T C 5: 70,782,465 E108G probably damaging Het
Gm29394 A G 15: 58,069,326 L5P probably benign Het
Gnb1l C T 16: 18,544,164 P101S probably benign Het
Hectd4 C A 5: 121,286,781 S749* probably null Het
Hmcn2 A G 2: 31,354,730 Y733C probably damaging Het
Inafm1 G A 7: 16,273,134 L53F probably damaging Het
Iqgap3 G A 3: 88,104,350 R814H probably damaging Het
Map3k19 A G 1: 127,850,426 C21R probably benign Het
Maz A G 7: 127,025,752 F199L probably damaging Het
Mis18bp1 A G 12: 65,140,854 I825T probably damaging Het
Mpp3 T A 11: 102,016,680 T211S possibly damaging Het
Myo3b G A 2: 70,245,304 G579R probably benign Het
Nlrp4e T C 7: 23,320,772 V228A probably benign Het
Npepps T A 11: 97,258,353 probably null Het
Ntng1 A G 3: 109,934,908 L183P probably damaging Het
Olfr894 A G 9: 38,219,572 T247A probably benign Het
Pcdha4 A C 18: 36,953,687 I308L probably benign Het
Pear1 G T 3: 87,751,173 Q964K probably benign Het
Plekhg2 A T 7: 28,360,285 D1182E possibly damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Ptpn13 T A 5: 103,527,132 D658E possibly damaging Het
Ptprq T C 10: 107,688,393 Y493C possibly damaging Het
Rnd1 A G 15: 98,672,645 W107R probably damaging Het
Scn5a G A 9: 119,486,773 T1623M probably damaging Het
Sec23b T C 2: 144,568,644 I288T probably benign Het
Slfn14 T A 11: 83,283,907 H86L probably benign Het
Smchd1 G A 17: 71,394,833 H1055Y probably damaging Het
Sox13 G A 1: 133,388,476 P243S probably damaging Het
St3gal6 C A 16: 58,484,773 E109* probably null Het
Tmem2 T C 19: 21,826,089 S829P probably damaging Het
Traf4 T C 11: 78,165,427 D5G possibly damaging Het
Trank1 G T 9: 111,362,297 C458F probably benign Het
Ttc41 T C 10: 86,713,185 F81S probably benign Het
Tulp1 C T 17: 28,353,828 W451* probably null Het
Tyms T C 5: 30,064,112 I171V Het
Vmn2r115 T A 17: 23,359,210 N552K probably damaging Het
Zfp710 T A 7: 80,081,161 S29T possibly damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79423425 missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79402920 splice site probably benign
IGL01866:Mtrf1 APN 14 79401508 missense probably benign
IGL02290:Mtrf1 APN 14 79401811 nonsense probably null
IGL02929:Mtrf1 APN 14 79402833 missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79415980 missense possibly damaging 0.80
IGL03342:Mtrf1 APN 14 79415871 splice site probably benign
IGL03342:Mtrf1 APN 14 79415872 splice site probably null
R0212:Mtrf1 UTSW 14 79419279 missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79406850 missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79415887 missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79419268 nonsense probably null
R0981:Mtrf1 UTSW 14 79401590 missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79401833 missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79401671 missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79419267 missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79413080 missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79411650 missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79401688 missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79406587 missense probably benign
R5616:Mtrf1 UTSW 14 79401445 missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79402891 missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79413081 missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79423491 frame shift probably null
R7182:Mtrf1 UTSW 14 79423464 missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79423491 frame shift probably null
R7871:Mtrf1 UTSW 14 79406938 missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79401479 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCAAAGTTCCTTTCCCAACC -3'
(R):5'- CCTGCAGCAACATTTAGGGC -3'

Sequencing Primer
(F):5'- CCCAAACCTGCCTTAAAATATTCTTC -3'
(R):5'- GCTAAGAGCAGCTTCTACCTG -3'
Posted On 2022-08-09