Incidental Mutation 'R9594:Olfr1156'
ID 723138
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Name olfactory receptor 1156
Synonyms MOR174-3, GA_x6K02T2Q125-49433499-49432537
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R9594 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 87947053-87953100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87950200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 11 (E11G)
Ref Sequence ENSEMBL: ENSMUSP00000149665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000216191] [ENSMUST00000216726]
AlphaFold A2AVC3
Predicted Effect probably damaging
Transcript: ENSMUST00000099842
AA Change: E11G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216191
AA Change: E11G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216726
AA Change: E11G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,091 E207G Het
Aida T C 1: 183,314,077 V151A possibly damaging Het
Akap3 T C 6: 126,865,414 V332A probably damaging Het
Apobec3 T A 15: 79,906,452 W332R Het
Atf6 A G 1: 170,840,833 V166A probably benign Het
Bcl6b A G 11: 70,228,032 probably null Het
Brd3 G T 2: 27,450,361 P612Q probably damaging Het
Btg1 T A 10: 96,617,401 L26H probably damaging Het
Btg4 A G 9: 51,119,260 D220G probably damaging Het
Cd209e T C 8: 3,851,183 D157G probably benign Het
Dnah10 T C 5: 124,830,043 L4269P probably damaging Het
Dync1li2 C A 8: 104,428,120 K285N possibly damaging Het
Ehmt2 C A 17: 34,899,764 Q198K possibly damaging Het
Fam166b T G 4: 43,427,329 T332P unknown Het
Foxn3 C A 12: 99,393,035 probably benign Het
Fstl4 C T 11: 52,773,867 P8L probably benign Het
G6pc T C 11: 101,367,834 I13T possibly damaging Het
Ghrhr A G 6: 55,385,485 I356V probably benign Het
Gm14410 A T 2: 177,193,980 C164S probably damaging Het
Gm281 A T 14: 13,814,959 L858Q unknown Het
Gpcpd1 A T 2: 132,546,928 M308K possibly damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 152,795,631 probably null Het
Gpr179 T C 11: 97,334,901 K2143E probably benign Het
Grm2 G A 9: 106,647,209 T298I probably damaging Het
H2-T24 A T 17: 36,015,563 L148Q probably damaging Het
Hcn2 C T 10: 79,724,725 R297C probably damaging Het
Hic1 T C 11: 75,165,931 T711A possibly damaging Het
Ide T C 19: 37,287,115 D672G Het
Impg1 A G 9: 80,381,641 F378S probably damaging Het
Lipe T C 7: 25,398,703 probably benign Het
Lmo7 A G 14: 101,918,700 D1270G probably null Het
Mbnl1 A T 3: 60,613,438 H149L probably damaging Het
Mmel1 T C 4: 154,894,135 Y675H probably benign Het
Mrfap1 C A 5: 36,796,463 R44L probably damaging Het
Notch2 A G 3: 98,134,573 T1303A possibly damaging Het
Olfm3 A G 3: 115,090,136 D62G probably damaging Het
Olfr1337 T C 4: 118,781,755 I277V probably benign Het
Olfr483 T G 7: 108,103,456 I49S probably damaging Het
Olfr765 T A 10: 129,046,485 I193F probably benign Het
Olfr94 C G 17: 37,197,417 A109P possibly damaging Het
Olfr996 C T 2: 85,579,538 Q100* probably null Het
Pcbd2 A G 13: 55,733,036 Y68C probably benign Het
Phf3 G C 1: 30,829,922 Q682E probably benign Het
Ptpn6 C A 6: 124,727,765 R294L probably benign Het
Ptprz1 T A 6: 23,025,027 V1754D probably damaging Het
Rab36 T A 10: 75,052,041 I248K probably damaging Het
Rabac1 A G 7: 24,972,154 Y114H probably benign Het
Rag1 A G 2: 101,644,356 V147A probably benign Het
Rnf150 T A 8: 82,990,515 V217D probably damaging Het
Scarf2 G T 16: 17,802,609 C101F probably damaging Het
Sh3glb2 C T 2: 30,346,660 R230Q probably damaging Het
Slc13a1 A G 6: 24,089,101 V550A probably damaging Het
Slc9a3r2 G T 17: 24,649,948 T68K probably damaging Het
Sp140 A G 1: 85,632,514 N289S possibly damaging Het
Stac3 T A 10: 127,502,785 M1K probably null Het
Stk31 C T 6: 49,447,287 T845I possibly damaging Het
Sufu T C 19: 46,397,235 Y45H probably damaging Het
Tg T A 15: 66,735,260 C1834* probably null Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Tpcn1 T C 5: 120,547,956 T427A possibly damaging Het
Trim45 A G 3: 100,922,949 H13R probably benign Het
Trpv5 A G 6: 41,670,839 F347L probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp236 G T 18: 82,646,113 Q516K probably damaging Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R8222:Olfr1156 UTSW 2 87949444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAAATGACAGGTGGCTGAG -3'
(R):5'- CAGCAGTCAGTGTGTTTCAAAC -3'

Sequencing Primer
(F):5'- CCAGGTTTGCTATGACTG -3'
(R):5'- GCAGTCAGTGTGTTTCAAACAAAAG -3'
Posted On 2022-08-09