Incidental Mutation 'R9594:1110017D15Rik'
ID 723146
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene Name RIKEN cDNA 1110017D15 gene
Synonyms Smrp1, Cbe1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9594 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41505009-41517333 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41505091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 207 (E207G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000149596]
AlphaFold Q2MH31
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: E207G

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aida T C 1: 183,314,077 V151A possibly damaging Het
Akap3 T C 6: 126,865,414 V332A probably damaging Het
Apobec3 T A 15: 79,906,452 W332R Het
Atf6 A G 1: 170,840,833 V166A probably benign Het
Bcl6b A G 11: 70,228,032 probably null Het
Brd3 G T 2: 27,450,361 P612Q probably damaging Het
Btg1 T A 10: 96,617,401 L26H probably damaging Het
Btg4 A G 9: 51,119,260 D220G probably damaging Het
Cd209e T C 8: 3,851,183 D157G probably benign Het
Dnah10 T C 5: 124,830,043 L4269P probably damaging Het
Dync1li2 C A 8: 104,428,120 K285N possibly damaging Het
Ehmt2 C A 17: 34,899,764 Q198K possibly damaging Het
Fam166b T G 4: 43,427,329 T332P unknown Het
Foxn3 C A 12: 99,393,035 probably benign Het
Fstl4 C T 11: 52,773,867 P8L probably benign Het
G6pc T C 11: 101,367,834 I13T possibly damaging Het
Ghrhr A G 6: 55,385,485 I356V probably benign Het
Gm14410 A T 2: 177,193,980 C164S probably damaging Het
Gm281 A T 14: 13,814,959 L858Q unknown Het
Gpcpd1 A T 2: 132,546,928 M308K possibly damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 152,795,631 probably null Het
Gpr179 T C 11: 97,334,901 K2143E probably benign Het
Grm2 G A 9: 106,647,209 T298I probably damaging Het
H2-T24 A T 17: 36,015,563 L148Q probably damaging Het
Hcn2 C T 10: 79,724,725 R297C probably damaging Het
Hic1 T C 11: 75,165,931 T711A possibly damaging Het
Ide T C 19: 37,287,115 D672G Het
Impg1 A G 9: 80,381,641 F378S probably damaging Het
Lipe T C 7: 25,398,703 probably benign Het
Lmo7 A G 14: 101,918,700 D1270G probably null Het
Mbnl1 A T 3: 60,613,438 H149L probably damaging Het
Mmel1 T C 4: 154,894,135 Y675H probably benign Het
Mrfap1 C A 5: 36,796,463 R44L probably damaging Het
Notch2 A G 3: 98,134,573 T1303A possibly damaging Het
Olfm3 A G 3: 115,090,136 D62G probably damaging Het
Olfr1156 T C 2: 87,950,200 E11G probably damaging Het
Olfr1337 T C 4: 118,781,755 I277V probably benign Het
Olfr483 T G 7: 108,103,456 I49S probably damaging Het
Olfr765 T A 10: 129,046,485 I193F probably benign Het
Olfr94 C G 17: 37,197,417 A109P possibly damaging Het
Olfr996 C T 2: 85,579,538 Q100* probably null Het
Pcbd2 A G 13: 55,733,036 Y68C probably benign Het
Phf3 G C 1: 30,829,922 Q682E probably benign Het
Ptpn6 C A 6: 124,727,765 R294L probably benign Het
Ptprz1 T A 6: 23,025,027 V1754D probably damaging Het
Rab36 T A 10: 75,052,041 I248K probably damaging Het
Rabac1 A G 7: 24,972,154 Y114H probably benign Het
Rag1 A G 2: 101,644,356 V147A probably benign Het
Rnf150 T A 8: 82,990,515 V217D probably damaging Het
Scarf2 G T 16: 17,802,609 C101F probably damaging Het
Sh3glb2 C T 2: 30,346,660 R230Q probably damaging Het
Slc13a1 A G 6: 24,089,101 V550A probably damaging Het
Slc9a3r2 G T 17: 24,649,948 T68K probably damaging Het
Sp140 A G 1: 85,632,514 N289S possibly damaging Het
Stac3 T A 10: 127,502,785 M1K probably null Het
Stk31 C T 6: 49,447,287 T845I possibly damaging Het
Sufu T C 19: 46,397,235 Y45H probably damaging Het
Tg T A 15: 66,735,260 C1834* probably null Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Tpcn1 T C 5: 120,547,956 T427A possibly damaging Het
Trim45 A G 3: 100,922,949 H13R probably benign Het
Trpv5 A G 6: 41,670,839 F347L probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp236 G T 18: 82,646,113 Q516K probably damaging Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41505071 missense possibly damaging 0.93
R9493:1110017D15Rik UTSW 4 41508614 missense
Predicted Primers PCR Primer
(F):5'- GAACTCATCTCTGTGGTGATGG -3'
(R):5'- CAGCAGAACTTGAGGTCAGTG -3'

Sequencing Primer
(F):5'- ATATCTATCAGGAGGTGGGTCACTC -3'
(R):5'- AGAACTTGAGGTCAGTGATCGGTC -3'
Posted On 2022-08-09