Mutagenetix > Incidental Mutation

Incidental Mutation 'R9595:Cfap65'

723198

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R9595 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74907378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1352 (S1352P)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: S1352P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: S1352P

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,316,447	M921T	probably benign	Het
Ankrd33	T	C	15: 101,115,904		probably null	Het
Azin2	A	G	4: 128,959,824	V80A	probably benign	Het
Capza3	A	T	6: 140,041,986	I104F	probably benign	Het
Ccdc130	C	T	8: 84,261,771	V76I	probably damaging	Het
Cd177	A	G	7: 24,752,337	L418P	probably damaging	Het
Cd86	A	T	16: 36,620,913	V64D	probably damaging	Het
Chst10	C	A	1: 38,873,948		probably null	Het
Cyp2j13	G	T	4: 96,045,560	C362*	probably null	Het
Ddn	T	C	15: 98,807,696	T40A	possibly damaging	Het
Fam47e	G	C	5: 92,578,536	R111P	probably benign	Het
Fermt3	C	T	19: 7,002,251	V505M	probably damaging	Het
Flnc	A	G	6: 29,433,721	H88R	probably benign	Het
Glyat	A	G	19: 12,646,364	D48G	probably damaging	Het
Hdac5	A	G	11: 102,205,303	V348A	probably benign	Het
Ighv2-3	T	C	12: 113,611,464	K24E	probably benign	Het
Iglv1	A	G	16: 19,085,198	V57A	possibly damaging	Het
Il16	G	T	7: 83,673,065	Y347*	probably null	Het
Il20rb	G	A	9: 100,486,258	T24M	possibly damaging	Het
Itgae	A	G	11: 73,125,356	D797G	probably damaging	Het
Lrrc37a	T	A	11: 103,501,726	T958S	probably benign	Het
Mall	G	T	2: 127,729,831	Y12*	probably null	Het
N4bp3	C	T	11: 51,646,105	R47Q	probably damaging	Het
Nacad	T	C	11: 6,601,790	D467G	probably damaging	Het
Olfr1314	T	C	2: 112,092,030	T224A	probably damaging	Het
Olfr19	G	A	16: 16,673,606	A125V	probably damaging	Het
Olfr361	C	A	2: 37,085,192	K185N	possibly damaging	Het
Olfr366	T	A	2: 37,220,269	I260N	probably damaging	Het
Olfr46	T	C	7: 140,611,026	S279P	probably damaging	Het
Olfr873	A	G	9: 20,300,365	N56S	probably damaging	Het
Osbpl8	A	G	10: 111,273,048	E397G	probably damaging	Het
Pcmt1	A	T	10: 7,649,053	I111K	possibly damaging	Het
Pcnx	T	A	12: 81,918,914	H90Q		Het
Pde4dip	C	T	3: 97,694,891		probably null	Het
Peli2	T	A	14: 48,256,389	V356D	probably damaging	Het
Phyhipl	G	T	10: 70,559,682	C231*	probably null	Het
Pirb	A	T	7: 3,719,407	S146T	possibly damaging	Het
Rac1	G	A	5: 143,527,888		probably benign	Het
Sh3glb2	C	T	2: 30,346,660	R230Q	probably damaging	Het
Slc38a8	C	A	8: 119,482,664	C390F	probably benign	Het
Slc39a8	G	T	3: 135,886,927	L454F	possibly damaging	Het
Slit1	A	C	19: 41,649,412	I314S	probably damaging	Het
Son	T	G	16: 91,657,353	M996R	possibly damaging	Het
Sp4	A	G	12: 118,298,955	V452A	possibly damaging	Het
St5	C	T	7: 109,556,766	R259Q	probably damaging	Het
Tmf1	C	T	6: 97,158,496	D940N	probably damaging	Het
Tns3	G	A	11: 8,451,142	T1052M	possibly damaging	Het
Trim33	C	T	3: 103,352,034	P1013L	probably damaging	Het
Vmn1r175	A	T	7: 23,809,083	S40T	probably damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Wdr49	C	T	3: 75,358,440	C233Y	probably damaging	Het
Wrn	T	C	8: 33,268,933	E999G	probably benign	Het
Zfp142	A	T	1: 74,572,303	C778S	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCAAGCCTCTTACAGAG -3'
(R):5'- AGCTGTGACTTCCTTGCTG -3'

Sequencing Primer
(F):5'- TCTTTGAAGCTGGAGCCAGAC -3'
(R):5'- GTGACTTCCTTGCTGCCTTC -3'

Posted On

2022-08-09