Incidental Mutation 'R9595:Itgae'
ID 723233
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms CD103, alpha-E1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9595 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73090583-73147446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73125356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 797 (D797G)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: D797G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D797G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: D797G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D797G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,316,447 M921T probably benign Het
Ankrd33 T C 15: 101,115,904 probably null Het
Azin2 A G 4: 128,959,824 V80A probably benign Het
Capza3 A T 6: 140,041,986 I104F probably benign Het
Ccdc130 C T 8: 84,261,771 V76I probably damaging Het
Cd177 A G 7: 24,752,337 L418P probably damaging Het
Cd86 A T 16: 36,620,913 V64D probably damaging Het
Cfap65 A G 1: 74,907,378 S1352P probably damaging Het
Chst10 C A 1: 38,873,948 probably null Het
Cyp2j13 G T 4: 96,045,560 C362* probably null Het
Ddn T C 15: 98,807,696 T40A possibly damaging Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fermt3 C T 19: 7,002,251 V505M probably damaging Het
Flnc A G 6: 29,433,721 H88R probably benign Het
Glyat A G 19: 12,646,364 D48G probably damaging Het
Hdac5 A G 11: 102,205,303 V348A probably benign Het
Ighv2-3 T C 12: 113,611,464 K24E probably benign Het
Iglv1 A G 16: 19,085,198 V57A possibly damaging Het
Il16 G T 7: 83,673,065 Y347* probably null Het
Il20rb G A 9: 100,486,258 T24M possibly damaging Het
Lrrc37a T A 11: 103,501,726 T958S probably benign Het
Mall G T 2: 127,729,831 Y12* probably null Het
N4bp3 C T 11: 51,646,105 R47Q probably damaging Het
Nacad T C 11: 6,601,790 D467G probably damaging Het
Olfr1314 T C 2: 112,092,030 T224A probably damaging Het
Olfr19 G A 16: 16,673,606 A125V probably damaging Het
Olfr361 C A 2: 37,085,192 K185N possibly damaging Het
Olfr366 T A 2: 37,220,269 I260N probably damaging Het
Olfr46 T C 7: 140,611,026 S279P probably damaging Het
Olfr873 A G 9: 20,300,365 N56S probably damaging Het
Osbpl8 A G 10: 111,273,048 E397G probably damaging Het
Pcmt1 A T 10: 7,649,053 I111K possibly damaging Het
Pcnx T A 12: 81,918,914 H90Q Het
Pde4dip C T 3: 97,694,891 probably null Het
Peli2 T A 14: 48,256,389 V356D probably damaging Het
Phyhipl G T 10: 70,559,682 C231* probably null Het
Pirb A T 7: 3,719,407 S146T possibly damaging Het
Rac1 G A 5: 143,527,888 probably benign Het
Sh3glb2 C T 2: 30,346,660 R230Q probably damaging Het
Slc38a8 C A 8: 119,482,664 C390F probably benign Het
Slc39a8 G T 3: 135,886,927 L454F possibly damaging Het
Slit1 A C 19: 41,649,412 I314S probably damaging Het
Son T G 16: 91,657,353 M996R possibly damaging Het
Sp4 A G 12: 118,298,955 V452A possibly damaging Het
St5 C T 7: 109,556,766 R259Q probably damaging Het
Tmf1 C T 6: 97,158,496 D940N probably damaging Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trim33 C T 3: 103,352,034 P1013L probably damaging Het
Vmn1r175 A T 7: 23,809,083 S40T probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Wdr49 C T 3: 75,358,440 C233Y probably damaging Het
Wrn T C 8: 33,268,933 E999G probably benign Het
Zfp142 A T 1: 74,572,303 C778S probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8197:Itgae UTSW 11 73120384 missense probably benign
R8911:Itgae UTSW 11 73113621 missense probably damaging 1.00
R9155:Itgae UTSW 11 73125263 missense possibly damaging 0.94
R9284:Itgae UTSW 11 73121926 missense probably benign 0.25
R9355:Itgae UTSW 11 73116080 missense probably damaging 1.00
R9414:Itgae UTSW 11 73111803 missense possibly damaging 0.59
R9618:Itgae UTSW 11 73120345 missense possibly damaging 0.78
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1192:Itgae UTSW 11 73134127 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTGGTGGCTTGAGGAACAGC -3'
(R):5'- ATAAACAGCAGCCATCTTGGGAG -3'

Sequencing Primer
(F):5'- GCCTGGATCCCTTGGAAGACTTC -3'
(R):5'- AGCTCCACTTCCTTGCTGACAG -3'
Posted On 2022-08-09