Mutagenetix > Incidental Mutation

Incidental Mutation 'R9595:Itgae'

723233

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9595 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73016182 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 797 (D797G)

Ref Sequence

ENSEMBL: ENSMUSP00000006101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably damaging
Transcript: ENSMUST00000006101
AA Change: D797G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D797G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102537
AA Change: D797G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D797G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,464,566 (GRCm39)	M921T	probably benign	Het
Ankrd33	T	C	15: 101,013,785 (GRCm39)		probably null	Het
Azin2	A	G	4: 128,853,617 (GRCm39)	V80A	probably benign	Het
Capza3	A	T	6: 139,987,712 (GRCm39)	I104F	probably benign	Het
Cd177	A	G	7: 24,451,762 (GRCm39)	L418P	probably damaging	Het
Cd86	A	T	16: 36,441,275 (GRCm39)	V64D	probably damaging	Het
Cfap65	A	G	1: 74,946,537 (GRCm39)	S1352P	probably damaging	Het
Chst10	C	A	1: 38,913,029 (GRCm39)		probably null	Het
Cyp2j13	G	T	4: 95,933,797 (GRCm39)	C362*	probably null	Het
Ddn	T	C	15: 98,705,577 (GRCm39)	T40A	possibly damaging	Het
Dennd2b	C	T	7: 109,155,973 (GRCm39)	R259Q	probably damaging	Het
Fam47e	G	C	5: 92,726,395 (GRCm39)	R111P	probably benign	Het
Fermt3	C	T	19: 6,979,619 (GRCm39)	V505M	probably damaging	Het
Flnc	A	G	6: 29,433,720 (GRCm39)	H88R	probably benign	Het
Glyat	A	G	19: 12,623,728 (GRCm39)	D48G	probably damaging	Het
Hdac5	A	G	11: 102,096,129 (GRCm39)	V348A	probably benign	Het
Ighv2-3	T	C	12: 113,575,084 (GRCm39)	K24E	probably benign	Het
Iglv1	A	G	16: 18,903,948 (GRCm39)	V57A	possibly damaging	Het
Il16	G	T	7: 83,322,273 (GRCm39)	Y347*	probably null	Het
Il20rb	G	A	9: 100,368,311 (GRCm39)	T24M	possibly damaging	Het
Lrrc37a	T	A	11: 103,392,552 (GRCm39)	T958S	probably benign	Het
Mall	G	T	2: 127,571,751 (GRCm39)	Y12*	probably null	Het
N4bp3	C	T	11: 51,536,932 (GRCm39)	R47Q	probably damaging	Het
Nacad	T	C	11: 6,551,790 (GRCm39)	D467G	probably damaging	Het
Or12k8	C	A	2: 36,975,204 (GRCm39)	K185N	possibly damaging	Het
Or13a18	T	C	7: 140,190,939 (GRCm39)	S279P	probably damaging	Het
Or1af1	T	A	2: 37,110,281 (GRCm39)	I260N	probably damaging	Het
Or4f61	T	C	2: 111,922,375 (GRCm39)	T224A	probably damaging	Het
Or7a40	G	A	16: 16,491,470 (GRCm39)	A125V	probably damaging	Het
Or7e177	A	G	9: 20,211,661 (GRCm39)	N56S	probably damaging	Het
Osbpl8	A	G	10: 111,108,909 (GRCm39)	E397G	probably damaging	Het
Pcmt1	A	T	10: 7,524,817 (GRCm39)	I111K	possibly damaging	Het
Pcnx1	T	A	12: 81,965,688 (GRCm39)	H90Q		Het
Pde4dip	C	T	3: 97,602,207 (GRCm39)		probably null	Het
Peli2	T	A	14: 48,493,846 (GRCm39)	V356D	probably damaging	Het
Phyhipl	G	T	10: 70,395,512 (GRCm39)	C231*	probably null	Het
Pirb	A	T	7: 3,722,406 (GRCm39)	S146T	possibly damaging	Het
Rac1	G	A	5: 143,513,643 (GRCm39)		probably benign	Het
Sh3glb2	C	T	2: 30,236,672 (GRCm39)	R230Q	probably damaging	Het
Slc38a8	C	A	8: 120,209,403 (GRCm39)	C390F	probably benign	Het
Slc39a8	G	T	3: 135,592,688 (GRCm39)	L454F	possibly damaging	Het
Slit1	A	C	19: 41,637,851 (GRCm39)	I314S	probably damaging	Het
Son	T	G	16: 91,454,241 (GRCm39)	M996R	possibly damaging	Het
Sp4	A	G	12: 118,262,690 (GRCm39)	V452A	possibly damaging	Het
Tmf1	C	T	6: 97,135,457 (GRCm39)	D940N	probably damaging	Het
Tns3	G	A	11: 8,401,142 (GRCm39)	T1052M	possibly damaging	Het
Trim33	C	T	3: 103,259,350 (GRCm39)	P1013L	probably damaging	Het
Vmn1r175	A	T	7: 23,508,508 (GRCm39)	S40T	probably damaging	Het
Vmn1r43	G	A	6: 89,846,877 (GRCm39)	T203M	probably damaging	Het
Wdr49	C	T	3: 75,265,747 (GRCm39)	C233Y	probably damaging	Het
Wrn	T	C	8: 33,758,961 (GRCm39)	E999G	probably benign	Het
Yju2b	C	T	8: 84,988,400 (GRCm39)	V76I	probably damaging	Het
Zfp142	A	T	1: 74,611,462 (GRCm39)	C778S	probably damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,016,188 (GRCm39)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,012,763 (GRCm39)	nonsense	probably null
R2680:Itgae	UTSW	11	73,005,752 (GRCm39)	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73,031,513 (GRCm39)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- TTGGTGGCTTGAGGAACAGC -3'
(R):5'- ATAAACAGCAGCCATCTTGGGAG -3'

Sequencing Primer
(F):5'- GCCTGGATCCCTTGGAAGACTTC -3'
(R):5'- AGCTCCACTTCCTTGCTGACAG -3'

Posted On

2022-08-09