Mutagenetix > Incidental Mutation

Incidental Mutation 'R9596:Gm597'

723250

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R9596 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 28776607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 781 (M781I)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

probably benign
Transcript: ENSMUST00000059937
AA Change: M781I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: M781I

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	G	T	1: 74,281,103	Q355K	probably benign	Het
AI661453	T	C	17: 47,469,486	S188P	unknown	Het
Atp10a	A	G	7: 58,827,805	S1251G	probably damaging	Het
Ccr10	A	G	11: 101,174,192	F171L	probably benign	Het
Clec10a	A	T	11: 70,169,147	D65V	probably damaging	Het
Clybl	A	T	14: 122,311,356	I57L	probably benign	Het
Col5a1	G	T	2: 27,929,539	E218*	probably null	Het
Diaph1	G	A	18: 37,891,058	P576S	unknown	Het
Dsg1c	T	A	18: 20,283,304	I754N	probably benign	Het
Fam47e	G	C	5: 92,578,536	R111P	probably benign	Het
Fastkd3	G	A	13: 68,587,687	V519M	probably damaging	Het
Fhod3	T	A	18: 25,060,335	Y634*	probably null	Het
Frem3	G	A	8: 80,615,322	V1415I	probably benign	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Herc2	G	A	7: 56,184,847	S3191N		Het
Kif19a	A	T	11: 114,785,926	E527V	probably benign	Het
Lmbr1	C	A	5: 29,235,107	G420*	probably null	Het
Map3k9	A	G	12: 81,730,630	S526P	probably damaging	Het
Mink1	T	A	11: 70,607,089	L506Q	possibly damaging	Het
Mroh9	T	C	1: 163,066,007	I200V	probably damaging	Het
Mrps14	T	C	1: 160,199,552	V110A	possibly damaging	Het
Mta1	A	G	12: 113,126,850	Q209R	probably damaging	Het
Mtss1l	G	A	8: 110,732,057	S195N		Het
Nlgn1	T	A	3: 25,434,423	I583F	probably damaging	Het
Ntng1	T	C	3: 110,135,640		probably benign	Het
Olfr1490	A	G	19: 13,654,638	S70G	probably damaging	Het
Olfr209	A	G	16: 59,361,579	I213T	possibly damaging	Het
Olfr406	C	T	11: 74,269,463	H25Y	probably benign	Het
Olfr695	A	T	7: 106,714,205	Y159N	probably benign	Het
Olfr808	A	G	10: 129,768,119	T208A	probably damaging	Het
Pcdha12	A	T	18: 37,021,249	L340F	probably benign	Het
Pdk4	T	A	6: 5,491,842	M173L	probably benign	Het
Pds5a	A	G	5: 65,615,487	S1258P	probably benign	Het
Plcd1	A	T	9: 119,088,115	L22Q	probably benign	Het
Prag1	A	G	8: 36,102,959	D232G	probably damaging	Het
Rest	C	T	5: 77,275,294	T315M	probably damaging	Het
Scrn2	G	A	11: 97,033,081	V264M	probably damaging	Het
Sipa1l3	C	A	7: 29,332,266	V1513F	probably benign	Het
Slc44a1	T	A	4: 53,544,553	N421K	probably benign	Het
Smc6	G	T	12: 11,295,044	R662I	probably damaging	Het
Srcap	T	A	7: 127,531,864	W751R	probably damaging	Het
Sv2b	A	G	7: 75,117,714	F645L	probably damaging	Het
Sycp2	A	G	2: 178,348,419		probably null	Het
Syne4	A	G	7: 30,315,079	T41A	probably benign	Het
Tns3	G	A	11: 8,451,142	T1052M	possibly damaging	Het
Trap1	A	T	16: 4,053,510	I381N	probably damaging	Het
Tshz1	A	G	18: 84,013,779	S835P	possibly damaging	Het
Ttc37	T	C	13: 76,182,849	V1466A	possibly damaging	Het
Ube3b	T	A	5: 114,389,110	W130R	probably damaging	Het
Ubr5	G	A	15: 37,985,969	T2207I		Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn2r11	T	G	5: 109,053,697	I314L	possibly damaging	Het
Vmn2r15	T	A	5: 109,292,925	I356L	probably benign	Het
Vmn2r31	G	T	7: 7,394,293	T322N	probably benign	Het
Vmn2r8	A	T	5: 108,799,330	F519I	possibly damaging	Het
Wdr35	T	C	12: 8,986,092	F288L	probably benign	Het
Xab2	A	T	8: 3,613,018	V521D	probably damaging	Het
Zfp639	T	C	3: 32,520,120	F298S	probably damaging	Het
Zfp786	G	A	6: 47,820,472	R511*	probably null	Het
Zfp936	T	A	7: 43,190,410	C434S	probably damaging	Het
Zranb1	T	C	7: 132,950,417	F266L	probably benign	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1514:Gm597	UTSW	1	28778748	missense	possibly damaging	0.83
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2004:Gm597	UTSW	1	28777179	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R4415:Gm597	UTSW	1	28777133	missense	probably benign	0.01
R5010:Gm597	UTSW	1	28777862	missense	possibly damaging	0.52
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6757:Gm597	UTSW	1	28780110	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9632:Gm597	UTSW	1	28778039	missense	probably benign	0.20
R9656:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9659:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9661:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9663:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9710:Gm597	UTSW	1	28778039	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CAACAACTGACTCCTGTTTGTC -3'
(R):5'- ACTCTGAGGTCCTCCATGAAC -3'

Sequencing Primer
(F):5'- AACTGACTCCTGTTTGTCTATAATTC -3'
(R):5'- TCTGAGGTCCTCCATGAACCAAAC -3'

Posted On

2022-08-09