Incidental Mutation 'R9596:Gm597'
ID 723250
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 28776607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 781 (M781I)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: M781I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: M781I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp G T 1: 74,281,103 Q355K probably benign Het
AI661453 T C 17: 47,469,486 S188P unknown Het
Atp10a A G 7: 58,827,805 S1251G probably damaging Het
Ccr10 A G 11: 101,174,192 F171L probably benign Het
Clec10a A T 11: 70,169,147 D65V probably damaging Het
Clybl A T 14: 122,311,356 I57L probably benign Het
Col5a1 G T 2: 27,929,539 E218* probably null Het
Diaph1 G A 18: 37,891,058 P576S unknown Het
Dsg1c T A 18: 20,283,304 I754N probably benign Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fastkd3 G A 13: 68,587,687 V519M probably damaging Het
Fhod3 T A 18: 25,060,335 Y634* probably null Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Herc2 G A 7: 56,184,847 S3191N Het
Kif19a A T 11: 114,785,926 E527V probably benign Het
Lmbr1 C A 5: 29,235,107 G420* probably null Het
Map3k9 A G 12: 81,730,630 S526P probably damaging Het
Mink1 T A 11: 70,607,089 L506Q possibly damaging Het
Mroh9 T C 1: 163,066,007 I200V probably damaging Het
Mrps14 T C 1: 160,199,552 V110A possibly damaging Het
Mta1 A G 12: 113,126,850 Q209R probably damaging Het
Mtss1l G A 8: 110,732,057 S195N Het
Nlgn1 T A 3: 25,434,423 I583F probably damaging Het
Ntng1 T C 3: 110,135,640 probably benign Het
Olfr1490 A G 19: 13,654,638 S70G probably damaging Het
Olfr209 A G 16: 59,361,579 I213T possibly damaging Het
Olfr406 C T 11: 74,269,463 H25Y probably benign Het
Olfr695 A T 7: 106,714,205 Y159N probably benign Het
Olfr808 A G 10: 129,768,119 T208A probably damaging Het
Pcdha12 A T 18: 37,021,249 L340F probably benign Het
Pdk4 T A 6: 5,491,842 M173L probably benign Het
Pds5a A G 5: 65,615,487 S1258P probably benign Het
Plcd1 A T 9: 119,088,115 L22Q probably benign Het
Prag1 A G 8: 36,102,959 D232G probably damaging Het
Rest C T 5: 77,275,294 T315M probably damaging Het
Scrn2 G A 11: 97,033,081 V264M probably damaging Het
Sipa1l3 C A 7: 29,332,266 V1513F probably benign Het
Slc44a1 T A 4: 53,544,553 N421K probably benign Het
Smc6 G T 12: 11,295,044 R662I probably damaging Het
Srcap T A 7: 127,531,864 W751R probably damaging Het
Sv2b A G 7: 75,117,714 F645L probably damaging Het
Sycp2 A G 2: 178,348,419 probably null Het
Syne4 A G 7: 30,315,079 T41A probably benign Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trap1 A T 16: 4,053,510 I381N probably damaging Het
Tshz1 A G 18: 84,013,779 S835P possibly damaging Het
Ttc37 T C 13: 76,182,849 V1466A possibly damaging Het
Ube3b T A 5: 114,389,110 W130R probably damaging Het
Ubr5 G A 15: 37,985,969 T2207I Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r11 T G 5: 109,053,697 I314L possibly damaging Het
Vmn2r15 T A 5: 109,292,925 I356L probably benign Het
Vmn2r31 G T 7: 7,394,293 T322N probably benign Het
Vmn2r8 A T 5: 108,799,330 F519I possibly damaging Het
Wdr35 T C 12: 8,986,092 F288L probably benign Het
Xab2 A T 8: 3,613,018 V521D probably damaging Het
Zfp639 T C 3: 32,520,120 F298S probably damaging Het
Zfp786 G A 6: 47,820,472 R511* probably null Het
Zfp936 T A 7: 43,190,410 C434S probably damaging Het
Zranb1 T C 7: 132,950,417 F266L probably benign Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CAACAACTGACTCCTGTTTGTC -3'
(R):5'- ACTCTGAGGTCCTCCATGAAC -3'

Sequencing Primer
(F):5'- AACTGACTCCTGTTTGTCTATAATTC -3'
(R):5'- TCTGAGGTCCTCCATGAACCAAAC -3'
Posted On 2022-08-09