Incidental Mutation 'R9596:Tns3'
ID 723288
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R9596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8401142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1052 (T1052M)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: T1052M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: T1052M

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp G T 1: 74,320,262 (GRCm39) Q355K probably benign Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
AI661453 T C 17: 47,780,411 (GRCm39) S188P unknown Het
Atp10a A G 7: 58,477,553 (GRCm39) S1251G probably damaging Het
Ccr10 A G 11: 101,065,018 (GRCm39) F171L probably benign Het
Clec10a A T 11: 70,059,973 (GRCm39) D65V probably damaging Het
Clybl A T 14: 122,548,768 (GRCm39) I57L probably benign Het
Col5a1 G T 2: 27,819,551 (GRCm39) E218* probably null Het
Diaph1 G A 18: 38,024,111 (GRCm39) P576S unknown Het
Dsg1c T A 18: 20,416,361 (GRCm39) I754N probably benign Het
Fam47e G C 5: 92,726,395 (GRCm39) R111P probably benign Het
Fastkd3 G A 13: 68,735,806 (GRCm39) V519M probably damaging Het
Fhod3 T A 18: 25,193,392 (GRCm39) Y634* probably null Het
Frem3 G A 8: 81,341,951 (GRCm39) V1415I probably benign Het
Herc2 G A 7: 55,834,595 (GRCm39) S3191N Het
Kif19a A T 11: 114,676,752 (GRCm39) E527V probably benign Het
Lmbr1 C A 5: 29,440,105 (GRCm39) G420* probably null Het
Map3k9 A G 12: 81,777,404 (GRCm39) S526P probably damaging Het
Mink1 T A 11: 70,497,915 (GRCm39) L506Q possibly damaging Het
Mroh9 T C 1: 162,893,576 (GRCm39) I200V probably damaging Het
Mrps14 T C 1: 160,027,122 (GRCm39) V110A possibly damaging Het
Mta1 A G 12: 113,090,470 (GRCm39) Q209R probably damaging Het
Mtss2 G A 8: 111,458,689 (GRCm39) S195N Het
Nlgn1 T A 3: 25,488,587 (GRCm39) I583F probably damaging Het
Ntng1 T C 3: 110,042,956 (GRCm39) probably benign Het
Or10w1 A G 19: 13,632,002 (GRCm39) S70G probably damaging Het
Or1p1c C T 11: 74,160,289 (GRCm39) H25Y probably benign Het
Or2ag13 A T 7: 106,313,412 (GRCm39) Y159N probably benign Het
Or5ac25 A G 16: 59,181,942 (GRCm39) I213T possibly damaging Het
Or6c65 A G 10: 129,603,988 (GRCm39) T208A probably damaging Het
Pcdha12 A T 18: 37,154,302 (GRCm39) L340F probably benign Het
Pdk4 T A 6: 5,491,842 (GRCm39) M173L probably benign Het
Pds5a A G 5: 65,772,830 (GRCm39) S1258P probably benign Het
Plcd1 A T 9: 118,917,183 (GRCm39) L22Q probably benign Het
Prag1 A G 8: 36,570,113 (GRCm39) D232G probably damaging Het
Rest C T 5: 77,423,141 (GRCm39) T315M probably damaging Het
Scrn2 G A 11: 96,923,907 (GRCm39) V264M probably damaging Het
Sipa1l3 C A 7: 29,031,691 (GRCm39) V1513F probably benign Het
Skic3 T C 13: 76,330,968 (GRCm39) V1466A possibly damaging Het
Slc44a1 T A 4: 53,544,553 (GRCm39) N421K probably benign Het
Smc6 G T 12: 11,345,045 (GRCm39) R662I probably damaging Het
Spata31e5 C A 1: 28,815,688 (GRCm39) M781I probably benign Het
Srcap T A 7: 127,131,036 (GRCm39) W751R probably damaging Het
Sv2b A G 7: 74,767,462 (GRCm39) F645L probably damaging Het
Sycp2 A G 2: 177,990,212 (GRCm39) probably null Het
Syne4 A G 7: 30,014,504 (GRCm39) T41A probably benign Het
Trap1 A T 16: 3,871,374 (GRCm39) I381N probably damaging Het
Tshz1 A G 18: 84,031,904 (GRCm39) S835P possibly damaging Het
Ube3b T A 5: 114,527,171 (GRCm39) W130R probably damaging Het
Ubr5 G A 15: 37,986,213 (GRCm39) T2207I Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn2r11 T G 5: 109,201,563 (GRCm39) I314L possibly damaging Het
Vmn2r15 T A 5: 109,440,791 (GRCm39) I356L probably benign Het
Vmn2r31 G T 7: 7,397,292 (GRCm39) T322N probably benign Het
Vmn2r8 A T 5: 108,947,196 (GRCm39) F519I possibly damaging Het
Wdr35 T C 12: 9,036,092 (GRCm39) F288L probably benign Het
Xab2 A T 8: 3,663,018 (GRCm39) V521D probably damaging Het
Zfp639 T C 3: 32,574,269 (GRCm39) F298S probably damaging Het
Zfp786 G A 6: 47,797,406 (GRCm39) R511* probably null Het
Zfp936 T A 7: 42,839,834 (GRCm39) C434S probably damaging Het
Zranb1 T C 7: 132,552,146 (GRCm39) F266L probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGAAGTCTGGAAGGACATTC -3'
(R):5'- TGTCCATGTCAGAGCCTCAG -3'

Sequencing Primer
(F):5'- ATGCTCATGGTGCTGCC -3'
(R):5'- CAGAGCCTCAGGGTGCTTTG -3'
Posted On 2022-08-09