Incidental Mutation 'R9596:Tns3'
ID 723288
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms TEM6, F830010I22Rik, Tens1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R9596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 8431652-8664535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8451142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1052 (T1052M)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: T1052M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: T1052M

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp G T 1: 74,281,103 Q355K probably benign Het
AI661453 T C 17: 47,469,486 S188P unknown Het
Atp10a A G 7: 58,827,805 S1251G probably damaging Het
Ccr10 A G 11: 101,174,192 F171L probably benign Het
Clec10a A T 11: 70,169,147 D65V probably damaging Het
Clybl A T 14: 122,311,356 I57L probably benign Het
Col5a1 G T 2: 27,929,539 E218* probably null Het
Diaph1 G A 18: 37,891,058 P576S unknown Het
Dsg1c T A 18: 20,283,304 I754N probably benign Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fastkd3 G A 13: 68,587,687 V519M probably damaging Het
Fhod3 T A 18: 25,060,335 Y634* probably null Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 C A 1: 28,776,607 M781I probably benign Het
Herc2 G A 7: 56,184,847 S3191N Het
Kif19a A T 11: 114,785,926 E527V probably benign Het
Lmbr1 C A 5: 29,235,107 G420* probably null Het
Map3k9 A G 12: 81,730,630 S526P probably damaging Het
Mink1 T A 11: 70,607,089 L506Q possibly damaging Het
Mroh9 T C 1: 163,066,007 I200V probably damaging Het
Mrps14 T C 1: 160,199,552 V110A possibly damaging Het
Mta1 A G 12: 113,126,850 Q209R probably damaging Het
Mtss1l G A 8: 110,732,057 S195N Het
Nlgn1 T A 3: 25,434,423 I583F probably damaging Het
Ntng1 T C 3: 110,135,640 probably benign Het
Olfr1490 A G 19: 13,654,638 S70G probably damaging Het
Olfr209 A G 16: 59,361,579 I213T possibly damaging Het
Olfr406 C T 11: 74,269,463 H25Y probably benign Het
Olfr695 A T 7: 106,714,205 Y159N probably benign Het
Olfr808 A G 10: 129,768,119 T208A probably damaging Het
Pcdha12 A T 18: 37,021,249 L340F probably benign Het
Pdk4 T A 6: 5,491,842 M173L probably benign Het
Pds5a A G 5: 65,615,487 S1258P probably benign Het
Plcd1 A T 9: 119,088,115 L22Q probably benign Het
Prag1 A G 8: 36,102,959 D232G probably damaging Het
Rest C T 5: 77,275,294 T315M probably damaging Het
Scrn2 G A 11: 97,033,081 V264M probably damaging Het
Sipa1l3 C A 7: 29,332,266 V1513F probably benign Het
Slc44a1 T A 4: 53,544,553 N421K probably benign Het
Smc6 G T 12: 11,295,044 R662I probably damaging Het
Srcap T A 7: 127,531,864 W751R probably damaging Het
Sv2b A G 7: 75,117,714 F645L probably damaging Het
Sycp2 A G 2: 178,348,419 probably null Het
Syne4 A G 7: 30,315,079 T41A probably benign Het
Trap1 A T 16: 4,053,510 I381N probably damaging Het
Tshz1 A G 18: 84,013,779 S835P possibly damaging Het
Ttc37 T C 13: 76,182,849 V1466A possibly damaging Het
Ube3b T A 5: 114,389,110 W130R probably damaging Het
Ubr5 G A 15: 37,985,969 T2207I Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r11 T G 5: 109,053,697 I314L possibly damaging Het
Vmn2r15 T A 5: 109,292,925 I356L probably benign Het
Vmn2r31 G T 7: 7,394,293 T322N probably benign Het
Vmn2r8 A T 5: 108,799,330 F519I possibly damaging Het
Wdr35 T C 12: 8,986,092 F288L probably benign Het
Xab2 A T 8: 3,613,018 V521D probably damaging Het
Zfp639 T C 3: 32,520,120 F298S probably damaging Het
Zfp786 G A 6: 47,820,472 R511* probably null Het
Zfp936 T A 7: 43,190,410 C434S probably damaging Het
Zranb1 T C 7: 132,950,417 F266L probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
R8790:Tns3 UTSW 11 8518273 missense probably damaging 0.99
R9228:Tns3 UTSW 11 8450094 missense probably damaging 1.00
R9374:Tns3 UTSW 11 8492606 missense probably damaging 1.00
R9476:Tns3 UTSW 11 8445702 missense probably damaging 0.99
R9510:Tns3 UTSW 11 8445702 missense probably damaging 0.99
R9594:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGAAGTCTGGAAGGACATTC -3'
(R):5'- TGTCCATGTCAGAGCCTCAG -3'

Sequencing Primer
(F):5'- ATGCTCATGGTGCTGCC -3'
(R):5'- CAGAGCCTCAGGGTGCTTTG -3'
Posted On 2022-08-09