Incidental Mutation 'R9596:Wdr35'
ID 723295
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 8973892-9028847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8986092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 288 (F288L)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000160329]
AlphaFold Q8BND3
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: F288L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: F288L

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: F288L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: F288L

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160329
SMART Domains Protein: ENSMUSP00000124285
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
low complexity region 172 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp G T 1: 74,281,103 Q355K probably benign Het
AI661453 T C 17: 47,469,486 S188P unknown Het
Atp10a A G 7: 58,827,805 S1251G probably damaging Het
Ccr10 A G 11: 101,174,192 F171L probably benign Het
Clec10a A T 11: 70,169,147 D65V probably damaging Het
Clybl A T 14: 122,311,356 I57L probably benign Het
Col5a1 G T 2: 27,929,539 E218* probably null Het
Diaph1 G A 18: 37,891,058 P576S unknown Het
Dsg1c T A 18: 20,283,304 I754N probably benign Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fastkd3 G A 13: 68,587,687 V519M probably damaging Het
Fhod3 T A 18: 25,060,335 Y634* probably null Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 C A 1: 28,776,607 M781I probably benign Het
Herc2 G A 7: 56,184,847 S3191N Het
Kif19a A T 11: 114,785,926 E527V probably benign Het
Lmbr1 C A 5: 29,235,107 G420* probably null Het
Map3k9 A G 12: 81,730,630 S526P probably damaging Het
Mink1 T A 11: 70,607,089 L506Q possibly damaging Het
Mroh9 T C 1: 163,066,007 I200V probably damaging Het
Mrps14 T C 1: 160,199,552 V110A possibly damaging Het
Mta1 A G 12: 113,126,850 Q209R probably damaging Het
Mtss1l G A 8: 110,732,057 S195N Het
Nlgn1 T A 3: 25,434,423 I583F probably damaging Het
Ntng1 T C 3: 110,135,640 probably benign Het
Olfr1490 A G 19: 13,654,638 S70G probably damaging Het
Olfr209 A G 16: 59,361,579 I213T possibly damaging Het
Olfr406 C T 11: 74,269,463 H25Y probably benign Het
Olfr695 A T 7: 106,714,205 Y159N probably benign Het
Olfr808 A G 10: 129,768,119 T208A probably damaging Het
Pcdha12 A T 18: 37,021,249 L340F probably benign Het
Pdk4 T A 6: 5,491,842 M173L probably benign Het
Pds5a A G 5: 65,615,487 S1258P probably benign Het
Plcd1 A T 9: 119,088,115 L22Q probably benign Het
Prag1 A G 8: 36,102,959 D232G probably damaging Het
Rest C T 5: 77,275,294 T315M probably damaging Het
Scrn2 G A 11: 97,033,081 V264M probably damaging Het
Sipa1l3 C A 7: 29,332,266 V1513F probably benign Het
Slc44a1 T A 4: 53,544,553 N421K probably benign Het
Smc6 G T 12: 11,295,044 R662I probably damaging Het
Srcap T A 7: 127,531,864 W751R probably damaging Het
Sv2b A G 7: 75,117,714 F645L probably damaging Het
Sycp2 A G 2: 178,348,419 probably null Het
Syne4 A G 7: 30,315,079 T41A probably benign Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trap1 A T 16: 4,053,510 I381N probably damaging Het
Tshz1 A G 18: 84,013,779 S835P possibly damaging Het
Ttc37 T C 13: 76,182,849 V1466A possibly damaging Het
Ube3b T A 5: 114,389,110 W130R probably damaging Het
Ubr5 G A 15: 37,985,969 T2207I Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r11 T G 5: 109,053,697 I314L possibly damaging Het
Vmn2r15 T A 5: 109,292,925 I356L probably benign Het
Vmn2r31 G T 7: 7,394,293 T322N probably benign Het
Vmn2r8 A T 5: 108,799,330 F519I possibly damaging Het
Xab2 A T 8: 3,613,018 V521D probably damaging Het
Zfp639 T C 3: 32,520,120 F298S probably damaging Het
Zfp786 G A 6: 47,820,472 R511* probably null Het
Zfp936 T A 7: 43,190,410 C434S probably damaging Het
Zranb1 T C 7: 132,950,417 F266L probably benign Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
R9220:Wdr35 UTSW 12 8986000 missense possibly damaging 0.49
R9368:Wdr35 UTSW 12 9021826 missense probably benign 0.00
R9573:Wdr35 UTSW 12 9028014 missense probably benign 0.00
R9773:Wdr35 UTSW 12 8989990 missense probably benign 0.03
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCTAGGCTAAGTTATGACCCAG -3'
(R):5'- CTTACAGAACACAATTTGGACACATGC -3'

Sequencing Primer
(F):5'- GCTAAGTTATGACCCAGCTGCC -3'
(R):5'- GGACACATGCTTGCTATCTGGAAAC -3'
Posted On 2022-08-09