Incidental Mutation 'R9596:Diaph1'
ID 723309
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Name diaphanous related formin 1
Synonyms Drf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37843601-37935476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37891058 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 576 (P576S)
Ref Sequence ENSEMBL: ENSMUSP00000078942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
AlphaFold O08808
Predicted Effect unknown
Transcript: ENSMUST00000025337
AA Change: P585S
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: P585S

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000080033
AA Change: P576S
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: P576S

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115629
AA Change: P541S
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: P541S

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115631
AA Change: P541S
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: P541S

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115634
AA Change: P576S
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: P576S

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp G T 1: 74,281,103 Q355K probably benign Het
AI661453 T C 17: 47,469,486 S188P unknown Het
Atp10a A G 7: 58,827,805 S1251G probably damaging Het
Ccr10 A G 11: 101,174,192 F171L probably benign Het
Clec10a A T 11: 70,169,147 D65V probably damaging Het
Clybl A T 14: 122,311,356 I57L probably benign Het
Col5a1 G T 2: 27,929,539 E218* probably null Het
Dsg1c T A 18: 20,283,304 I754N probably benign Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fastkd3 G A 13: 68,587,687 V519M probably damaging Het
Fhod3 T A 18: 25,060,335 Y634* probably null Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 C A 1: 28,776,607 M781I probably benign Het
Herc2 G A 7: 56,184,847 S3191N Het
Kif19a A T 11: 114,785,926 E527V probably benign Het
Lmbr1 C A 5: 29,235,107 G420* probably null Het
Map3k9 A G 12: 81,730,630 S526P probably damaging Het
Mink1 T A 11: 70,607,089 L506Q possibly damaging Het
Mroh9 T C 1: 163,066,007 I200V probably damaging Het
Mrps14 T C 1: 160,199,552 V110A possibly damaging Het
Mta1 A G 12: 113,126,850 Q209R probably damaging Het
Mtss1l G A 8: 110,732,057 S195N Het
Nlgn1 T A 3: 25,434,423 I583F probably damaging Het
Ntng1 T C 3: 110,135,640 probably benign Het
Olfr1490 A G 19: 13,654,638 S70G probably damaging Het
Olfr209 A G 16: 59,361,579 I213T possibly damaging Het
Olfr406 C T 11: 74,269,463 H25Y probably benign Het
Olfr695 A T 7: 106,714,205 Y159N probably benign Het
Olfr808 A G 10: 129,768,119 T208A probably damaging Het
Pcdha12 A T 18: 37,021,249 L340F probably benign Het
Pdk4 T A 6: 5,491,842 M173L probably benign Het
Pds5a A G 5: 65,615,487 S1258P probably benign Het
Plcd1 A T 9: 119,088,115 L22Q probably benign Het
Prag1 A G 8: 36,102,959 D232G probably damaging Het
Rest C T 5: 77,275,294 T315M probably damaging Het
Scrn2 G A 11: 97,033,081 V264M probably damaging Het
Sipa1l3 C A 7: 29,332,266 V1513F probably benign Het
Slc44a1 T A 4: 53,544,553 N421K probably benign Het
Smc6 G T 12: 11,295,044 R662I probably damaging Het
Srcap T A 7: 127,531,864 W751R probably damaging Het
Sv2b A G 7: 75,117,714 F645L probably damaging Het
Sycp2 A G 2: 178,348,419 probably null Het
Syne4 A G 7: 30,315,079 T41A probably benign Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trap1 A T 16: 4,053,510 I381N probably damaging Het
Tshz1 A G 18: 84,013,779 S835P possibly damaging Het
Ttc37 T C 13: 76,182,849 V1466A possibly damaging Het
Ube3b T A 5: 114,389,110 W130R probably damaging Het
Ubr5 G A 15: 37,985,969 T2207I Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r11 T G 5: 109,053,697 I314L possibly damaging Het
Vmn2r15 T A 5: 109,292,925 I356L probably benign Het
Vmn2r31 G T 7: 7,394,293 T322N probably benign Het
Vmn2r8 A T 5: 108,799,330 F519I possibly damaging Het
Wdr35 T C 12: 8,986,092 F288L probably benign Het
Xab2 A T 8: 3,613,018 V521D probably damaging Het
Zfp639 T C 3: 32,520,120 F298S probably damaging Het
Zfp786 G A 6: 47,820,472 R511* probably null Het
Zfp936 T A 7: 43,190,410 C434S probably damaging Het
Zranb1 T C 7: 132,950,417 F266L probably benign Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
fishnets UTSW 18 37895300 critical splice acceptor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
saran UTSW 18 37855804 missense probably damaging 1.00
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 splice site probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 splice site probably null
R7703:Diaph1 UTSW 18 37890809 missense unknown
R7834:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R8073:Diaph1 UTSW 18 37891797 missense unknown
R8378:Diaph1 UTSW 18 37891953 missense unknown
R8847:Diaph1 UTSW 18 37854537 missense possibly damaging 0.71
R8947:Diaph1 UTSW 18 37853701 missense probably damaging 1.00
R8990:Diaph1 UTSW 18 37855804 missense probably damaging 1.00
R9059:Diaph1 UTSW 18 37889745 missense possibly damaging 0.53
R9189:Diaph1 UTSW 18 37891109 missense unknown
R9297:Diaph1 UTSW 18 37889775 missense probably benign 0.26
R9438:Diaph1 UTSW 18 37893390 missense unknown
R9439:Diaph1 UTSW 18 37896359 critical splice donor site probably null
R9538:Diaph1 UTSW 18 37853417 missense probably damaging 1.00
R9752:Diaph1 UTSW 18 37903071 missense unknown
R9762:Diaph1 UTSW 18 37854536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTTCCAGGCAAAGGAG -3'
(R):5'- GCTGCCTGCACATACTTCAG -3'

Sequencing Primer
(F):5'- TGTACCTCCAGGCAAAGGG -3'
(R):5'- AGAGTCATGTGATCTTGTGACCACTC -3'
Posted On 2022-08-09