Incidental Mutation 'R9597:Slc23a2'
ID 723323
Institutional Source Beutler Lab
Gene Symbol Slc23a2
Ensembl Gene ENSMUSG00000027340
Gene Name solute carrier family 23 (nucleobase transporters), member 2
Synonyms Slc23a1, SVCT2, YSPL3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 132052496-132145108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 132062178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 454 (R454L)
Ref Sequence ENSEMBL: ENSMUSP00000028815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028815]
AlphaFold Q9EPR4
Predicted Effect probably damaging
Transcript: ENSMUST00000028815
AA Change: R454L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: R454L

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 101 534 1.7e-93 PFAM
transmembrane domain 547 566 N/A INTRINSIC
low complexity region 578 592 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,633,087 E952G possibly damaging Het
Abhd12 T C 2: 150,846,278 I170V probably benign Het
Ankmy1 A G 1: 92,877,051 V840A Het
Arhgap18 T A 10: 26,912,659 V589D probably damaging Het
Armc7 A G 11: 115,488,886 T137A probably benign Het
BC055324 A T 1: 163,976,771 L331Q probably null Het
Bcl9 A T 3: 97,210,007 I457K probably benign Het
Ccdc148 A T 2: 59,003,385 Y78N probably benign Het
Ccdc24 A G 4: 117,872,151 V43A probably damaging Het
Cep68 G A 11: 20,238,506 T633I probably benign Het
Cfap157 T C 2: 32,779,741 I277V probably benign Het
Clec4a2 C A 6: 123,139,332 A152E probably benign Het
Crocc2 G T 1: 93,190,495 C380F probably benign Het
Cyp2ab1 A T 16: 20,316,590 M54K probably benign Het
Fam19a4 A G 6: 97,014,468 W7R probably benign Het
Fbn1 C A 2: 125,345,986 R1541L probably benign Het
Fem1c G T 18: 46,505,295 L547I probably damaging Het
Fras1 A G 5: 96,740,692 D2699G probably damaging Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Kcnn2 T C 18: 45,683,082 V460A probably benign Het
Krt81 T C 15: 101,461,038 I278V probably benign Het
Lrp2 T A 2: 69,430,359 E4509D probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Myh2 G A 11: 67,173,476 D86N possibly damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Neto1 T C 18: 86,404,696 S93P possibly damaging Het
Obscn G T 11: 59,136,183 R65S probably benign Het
Olfr671 A G 7: 104,975,206 F264L probably benign Het
Pcdh7 A G 5: 57,719,855 T251A possibly damaging Het
Pramef20 A T 4: 144,376,956 V200E probably damaging Het
Prdm14 T C 1: 13,122,433 K361E possibly damaging Het
Rgs2 A G 1: 144,002,088 F125L probably damaging Het
Scd2 C A 19: 44,299,807 Q213K probably damaging Het
Smg1 T C 7: 118,213,047 D31G unknown Het
Spata7 T A 12: 98,634,300 N57K probably damaging Het
Spef2 T C 15: 9,599,811 M1983V unknown Het
Srcap G T 7: 127,522,047 R184L possibly damaging Het
Tbpl2 A G 2: 24,087,284 S241P probably damaging Het
Tcaim A G 9: 122,808,765 probably null Het
Tep1 G T 14: 50,863,008 A351E probably damaging Het
Tiparp A G 3: 65,531,280 T6A probably benign Het
Tmem62 T C 2: 120,999,086 F437L probably benign Het
Tpp1 A T 7: 105,747,507 H434Q probably benign Het
Vmn2r17 A G 5: 109,427,803 Y180C probably damaging Het
Vmn2r52 A T 7: 10,170,792 Y373* probably null Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Other mutations in Slc23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc23a2 APN 2 132101500 missense probably benign 0.00
IGL01123:Slc23a2 APN 2 132056816 missense probably benign 0.02
IGL03115:Slc23a2 APN 2 132091265 missense probably damaging 1.00
R0352:Slc23a2 UTSW 2 132060796 missense probably benign 0.03
R0446:Slc23a2 UTSW 2 132078433 missense probably benign 0.06
R0499:Slc23a2 UTSW 2 132072017 missense probably damaging 1.00
R1252:Slc23a2 UTSW 2 132062197 splice site probably null
R1663:Slc23a2 UTSW 2 132065464 missense probably damaging 1.00
R1768:Slc23a2 UTSW 2 132075641 missense probably benign
R1914:Slc23a2 UTSW 2 132056766 missense probably damaging 0.99
R2277:Slc23a2 UTSW 2 132091259 missense possibly damaging 0.54
R2326:Slc23a2 UTSW 2 132094195 missense possibly damaging 0.72
R2385:Slc23a2 UTSW 2 132089201 missense probably benign 0.01
R4049:Slc23a2 UTSW 2 132060683 missense probably benign 0.00
R4084:Slc23a2 UTSW 2 132091217 nonsense probably null
R4497:Slc23a2 UTSW 2 132056782 nonsense probably null
R4710:Slc23a2 UTSW 2 132056709 missense probably benign
R4873:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R4875:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R5008:Slc23a2 UTSW 2 132101494 missense probably damaging 0.99
R5164:Slc23a2 UTSW 2 132075450 intron probably benign
R5236:Slc23a2 UTSW 2 132075584 missense probably damaging 0.97
R6587:Slc23a2 UTSW 2 132078481 missense possibly damaging 0.70
R6738:Slc23a2 UTSW 2 132078436 missense probably benign 0.10
R6960:Slc23a2 UTSW 2 132091253 missense probably damaging 1.00
R7000:Slc23a2 UTSW 2 132094203 missense possibly damaging 0.93
R7062:Slc23a2 UTSW 2 132091269 missense probably damaging 0.99
R7293:Slc23a2 UTSW 2 132089106 missense probably benign 0.02
R7324:Slc23a2 UTSW 2 132089123 missense probably damaging 1.00
R8077:Slc23a2 UTSW 2 132089172 missense possibly damaging 0.51
R8794:Slc23a2 UTSW 2 132060709 missense probably benign 0.01
R8839:Slc23a2 UTSW 2 132101472 splice site silent
R8882:Slc23a2 UTSW 2 132091239 missense possibly damaging 0.82
R9129:Slc23a2 UTSW 2 132078412 critical splice donor site probably null
R9252:Slc23a2 UTSW 2 132071922 missense probably damaging 1.00
X0011:Slc23a2 UTSW 2 132091263 missense possibly damaging 0.64
X0018:Slc23a2 UTSW 2 132066806 missense probably benign 0.30
Z1176:Slc23a2 UTSW 2 132060788 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTCTGCCAACCTGAAGAC -3'
(R):5'- ACCTGTTCACAGCTGAAACAGTG -3'

Sequencing Primer
(F):5'- CAGCACGTGATGGTAAACTGCTAC -3'
(R):5'- TTCACAGCTGAAACAGTGAACTG -3'
Posted On 2022-08-09