Incidental Mutation 'R9598:Celsr2'
ID 723376
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9598 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108322578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 78 (E78G)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090558
AA Change: E78G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: E78G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,088,604 (GRCm39) I302V probably benign Het
Ackr2 A C 9: 121,737,657 (GRCm39) T11P possibly damaging Het
Ahnak A G 19: 8,981,149 (GRCm39) N811S probably benign Het
Atm T C 9: 53,431,381 (GRCm39) I326V probably benign Het
Ccn4 T A 15: 66,784,764 (GRCm39) C146S possibly damaging Het
Cdh23 A T 10: 60,214,574 (GRCm39) F1480L probably benign Het
Ces1f A T 8: 93,983,494 (GRCm39) N504K probably benign Het
Chrna4 G A 2: 180,679,264 (GRCm39) S61L probably damaging Het
Clcn3 G T 8: 61,366,061 (GRCm39) T864K unknown Het
Cym A C 3: 107,126,941 (GRCm39) D71E possibly damaging Het
Ddx19b T C 8: 111,747,673 (GRCm39) D87G probably benign Het
Dnah7b T C 1: 46,292,621 (GRCm39) V3002A possibly damaging Het
Dnmt3a G A 12: 3,946,997 (GRCm39) G408S probably benign Het
Dock10 A T 1: 80,625,939 (GRCm39) D66E probably benign Het
Dsg3 A G 18: 20,672,789 (GRCm39) D820G probably damaging Het
Dst G A 1: 34,153,014 (GRCm39) V92I possibly damaging Het
Dusp16 T A 6: 134,695,185 (GRCm39) T549S probably benign Het
Ephx1 T A 1: 180,827,381 (GRCm39) K91* probably null Het
Flii A G 11: 60,617,991 (GRCm39) F9L probably benign Het
Fmn2 T C 1: 174,436,308 (GRCm39) S760P unknown Het
Fmnl3 A T 15: 99,223,210 (GRCm39) V378E probably damaging Het
Gbp4 A G 5: 105,284,740 (GRCm39) S50P probably damaging Het
Glra3 G T 8: 56,393,718 (GRCm39) probably benign Het
Gm10188 T C 1: 132,157,033 (GRCm39) D111G unknown Het
Gnptab A T 10: 88,247,876 (GRCm39) E101V probably damaging Het
Hacl1 C A 14: 31,332,197 (GRCm39) M525I probably benign Het
Hid1 T A 11: 115,239,738 (GRCm39) T731S probably damaging Het
Ifi203 T C 1: 173,751,522 (GRCm39) Y847C probably damaging Het
Igfbpl1 C A 4: 45,815,472 (GRCm39) L221F probably null Het
Ighv1-12 A G 12: 114,579,757 (GRCm39) Y22H probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
L3mbtl4 T A 17: 68,866,767 (GRCm39) H335Q probably benign Het
Mapre2 A G 18: 24,016,707 (GRCm39) D287G probably benign Het
Mfsd14b G A 13: 65,214,522 (GRCm39) R477W probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Msh4 A T 3: 153,607,148 (GRCm39) S131T possibly damaging Het
Nat8f2 A T 6: 85,844,848 (GRCm39) D171E probably benign Het
Ndufb5 G T 3: 32,795,881 (GRCm39) L24F probably benign Het
Nkain2 T C 10: 32,278,291 (GRCm39) I45V probably damaging Het
Nlrp9b T G 7: 19,753,302 (GRCm39) M69R probably benign Het
Or4k37 A T 2: 111,159,633 (GRCm39) R290* probably null Het
Or5d39 A C 2: 87,979,935 (GRCm39) C143G probably damaging Het
Or5d46 A T 2: 88,170,821 (GRCm39) K304I possibly damaging Het
Oxct2b T A 4: 123,010,413 (GRCm39) V111E possibly damaging Het
Parva T A 7: 112,187,753 (GRCm39) V350D probably damaging Het
Pcdhb7 A G 18: 37,475,434 (GRCm39) D190G probably damaging Het
Pik3c2b T C 1: 133,012,725 (GRCm39) probably null Het
Plcz1 T A 6: 139,985,484 (GRCm39) Q19L possibly damaging Het
Prag1 A G 8: 36,571,069 (GRCm39) N551D probably benign Het
Rb1cc1 G A 1: 6,310,189 (GRCm39) V196I probably damaging Het
Rnf113a2 T C 12: 84,464,270 (GRCm39) V54A probably benign Het
Sec14l1 G A 11: 117,044,102 (GRCm39) E537K probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Shtn1 T A 19: 59,026,735 (GRCm39) I119F probably damaging Het
Szt2 A G 4: 118,266,358 (GRCm39) probably null Het
Tasp1 T C 2: 139,819,567 (GRCm39) D212G probably benign Het
Tmpo A G 10: 90,994,608 (GRCm39) probably null Het
Usp17lb T C 7: 104,489,718 (GRCm39) K403R probably benign Het
Vcpip1 A G 1: 9,816,019 (GRCm39) V788A probably benign Het
Wdr25 C A 12: 108,864,613 (GRCm39) H253N probably benign Het
Wwc2 G A 8: 48,328,360 (GRCm39) S367L probably damaging Het
Zfr A G 15: 12,162,292 (GRCm39) E814G probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108,321,378 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108,322,675 (GRCm39) missense unknown
R7326:Celsr2 UTSW 3 108,302,311 (GRCm39) missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9209:Celsr2 UTSW 3 108,321,349 (GRCm39) missense probably benign 0.02
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGGGTGCTCTTCAGGCAG -3'
(R):5'- CGCAGGTAGAGAACGCTCAG -3'

Sequencing Primer
(F):5'- TGCTCTTCAGGCAGGGTCAG -3'
(R):5'- GCATCGTGGGCTAAGAGC -3'
Posted On 2022-08-09