Incidental Mutation 'R9598:Szt2'
ID 723380
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R9598 (G1)
Quality Score 107.008
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 118266358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019229] [ENSMUST00000073881] [ENSMUST00000075406] [ENSMUST00000075406] [ENSMUST00000084319] [ENSMUST00000106384] [ENSMUST00000126089] [ENSMUST00000144577]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019229
SMART Domains Protein: ENSMUSP00000019229
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 265 1.2e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073881
SMART Domains Protein: ENSMUSP00000073544
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 129 1.4e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084319
SMART Domains Protein: ENSMUSP00000081346
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 179 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106384
SMART Domains Protein: ENSMUSP00000101992
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 234 3.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126089
Predicted Effect probably benign
Transcript: ENSMUST00000144577
SMART Domains Protein: ENSMUSP00000120158
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 75 3.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,088,604 (GRCm39) I302V probably benign Het
Ackr2 A C 9: 121,737,657 (GRCm39) T11P possibly damaging Het
Ahnak A G 19: 8,981,149 (GRCm39) N811S probably benign Het
Atm T C 9: 53,431,381 (GRCm39) I326V probably benign Het
Ccn4 T A 15: 66,784,764 (GRCm39) C146S possibly damaging Het
Cdh23 A T 10: 60,214,574 (GRCm39) F1480L probably benign Het
Celsr2 T C 3: 108,322,578 (GRCm39) E78G possibly damaging Het
Ces1f A T 8: 93,983,494 (GRCm39) N504K probably benign Het
Chrna4 G A 2: 180,679,264 (GRCm39) S61L probably damaging Het
Clcn3 G T 8: 61,366,061 (GRCm39) T864K unknown Het
Cym A C 3: 107,126,941 (GRCm39) D71E possibly damaging Het
Ddx19b T C 8: 111,747,673 (GRCm39) D87G probably benign Het
Dnah7b T C 1: 46,292,621 (GRCm39) V3002A possibly damaging Het
Dnmt3a G A 12: 3,946,997 (GRCm39) G408S probably benign Het
Dock10 A T 1: 80,625,939 (GRCm39) D66E probably benign Het
Dsg3 A G 18: 20,672,789 (GRCm39) D820G probably damaging Het
Dst G A 1: 34,153,014 (GRCm39) V92I possibly damaging Het
Dusp16 T A 6: 134,695,185 (GRCm39) T549S probably benign Het
Ephx1 T A 1: 180,827,381 (GRCm39) K91* probably null Het
Flii A G 11: 60,617,991 (GRCm39) F9L probably benign Het
Fmn2 T C 1: 174,436,308 (GRCm39) S760P unknown Het
Fmnl3 A T 15: 99,223,210 (GRCm39) V378E probably damaging Het
Gbp4 A G 5: 105,284,740 (GRCm39) S50P probably damaging Het
Glra3 G T 8: 56,393,718 (GRCm39) probably benign Het
Gm10188 T C 1: 132,157,033 (GRCm39) D111G unknown Het
Gnptab A T 10: 88,247,876 (GRCm39) E101V probably damaging Het
Hacl1 C A 14: 31,332,197 (GRCm39) M525I probably benign Het
Hid1 T A 11: 115,239,738 (GRCm39) T731S probably damaging Het
Ifi203 T C 1: 173,751,522 (GRCm39) Y847C probably damaging Het
Igfbpl1 C A 4: 45,815,472 (GRCm39) L221F probably null Het
Ighv1-12 A G 12: 114,579,757 (GRCm39) Y22H probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
L3mbtl4 T A 17: 68,866,767 (GRCm39) H335Q probably benign Het
Mapre2 A G 18: 24,016,707 (GRCm39) D287G probably benign Het
Mfsd14b G A 13: 65,214,522 (GRCm39) R477W probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Msh4 A T 3: 153,607,148 (GRCm39) S131T possibly damaging Het
Nat8f2 A T 6: 85,844,848 (GRCm39) D171E probably benign Het
Ndufb5 G T 3: 32,795,881 (GRCm39) L24F probably benign Het
Nkain2 T C 10: 32,278,291 (GRCm39) I45V probably damaging Het
Nlrp9b T G 7: 19,753,302 (GRCm39) M69R probably benign Het
Or4k37 A T 2: 111,159,633 (GRCm39) R290* probably null Het
Or5d39 A C 2: 87,979,935 (GRCm39) C143G probably damaging Het
Or5d46 A T 2: 88,170,821 (GRCm39) K304I possibly damaging Het
Oxct2b T A 4: 123,010,413 (GRCm39) V111E possibly damaging Het
Parva T A 7: 112,187,753 (GRCm39) V350D probably damaging Het
Pcdhb7 A G 18: 37,475,434 (GRCm39) D190G probably damaging Het
Pik3c2b T C 1: 133,012,725 (GRCm39) probably null Het
Plcz1 T A 6: 139,985,484 (GRCm39) Q19L possibly damaging Het
Prag1 A G 8: 36,571,069 (GRCm39) N551D probably benign Het
Rb1cc1 G A 1: 6,310,189 (GRCm39) V196I probably damaging Het
Rnf113a2 T C 12: 84,464,270 (GRCm39) V54A probably benign Het
Sec14l1 G A 11: 117,044,102 (GRCm39) E537K probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Shtn1 T A 19: 59,026,735 (GRCm39) I119F probably damaging Het
Tasp1 T C 2: 139,819,567 (GRCm39) D212G probably benign Het
Tmpo A G 10: 90,994,608 (GRCm39) probably null Het
Usp17lb T C 7: 104,489,718 (GRCm39) K403R probably benign Het
Vcpip1 A G 1: 9,816,019 (GRCm39) V788A probably benign Het
Wdr25 C A 12: 108,864,613 (GRCm39) H253N probably benign Het
Wwc2 G A 8: 48,328,360 (GRCm39) S367L probably damaging Het
Zfr A G 15: 12,162,292 (GRCm39) E814G probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGCACAATGAAAATCC -3'
(R):5'- TATAAGGCCCAACCCGCTTC -3'

Sequencing Primer
(F):5'- GCACAATGAAAATCCCAACTAATAAC -3'
(R):5'- CGGTTTCTCGCACGGCTTG -3'
Posted On 2022-08-09