Incidental Mutation 'R9599:Cse1l'
ID 723436
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166783386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 780 (N780S)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: N780S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: N780S

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: N467S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: N467S

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: N724S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: N724S

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,774,267 (GRCm39) N1152S probably benign Het
Abcb6 A T 1: 75,151,372 (GRCm39) Y518N possibly damaging Het
Actr2 G A 11: 20,030,745 (GRCm39) P168S probably damaging Het
Adam12 A G 7: 133,566,454 (GRCm39) V332A probably damaging Het
Adam23 T C 1: 63,620,359 (GRCm39) I805T probably benign Het
Adar A G 3: 89,654,516 (GRCm39) T883A probably benign Het
Aldh3a1 A G 11: 61,107,912 (GRCm39) T319A probably damaging Het
Apcdd1 T A 18: 63,083,269 (GRCm39) probably null Het
Arhgef18 C A 8: 3,482,718 (GRCm39) A141E possibly damaging Het
Bub3 A G 7: 131,170,428 (GRCm39) T317A probably benign Het
Ccdc102a A G 8: 95,639,901 (GRCm39) L131P probably damaging Het
Ccdc60 C A 5: 116,269,265 (GRCm39) D452Y probably damaging Het
Ccdc66 T C 14: 27,219,381 (GRCm39) E125G probably damaging Het
Ccdc68 A G 18: 70,093,492 (GRCm39) E233G probably damaging Het
Cep192 A G 18: 67,968,525 (GRCm39) D973G probably benign Het
Cox5b T A 1: 36,730,759 (GRCm39) M31K probably benign Het
Cyfip1 T C 7: 55,563,277 (GRCm39) probably null Het
Cyp1a1 C T 9: 57,607,770 (GRCm39) P133S probably benign Het
Dcp1a A G 14: 30,241,497 (GRCm39) M436V probably benign Het
Dcst1 G T 3: 89,265,075 (GRCm39) Y258* probably null Het
Dhx30 T C 9: 109,914,518 (GRCm39) E993G possibly damaging Het
Disc1 A T 8: 125,814,261 (GRCm39) M42L possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Entrep3 A G 3: 89,094,099 (GRCm39) D304G possibly damaging Het
Erbb2 A T 11: 98,318,216 (GRCm39) D484V probably benign Het
Fxr2 A G 11: 69,543,469 (GRCm39) N657D probably benign Het
Gbx2 T C 1: 89,856,635 (GRCm39) T252A probably damaging Het
Gdap2 A T 3: 100,078,264 (GRCm39) N76I probably damaging Het
Gm20939 A G 17: 95,184,666 (GRCm39) Y438C probably damaging Het
Gsdma2 A G 11: 98,540,459 (GRCm39) E126G possibly damaging Het
Gsg1 T G 6: 135,217,098 (GRCm39) H246P probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Ighv1-62-1 T C 12: 115,350,601 (GRCm39) Q22R possibly damaging Het
Kcng3 A T 17: 83,895,211 (GRCm39) F418L probably benign Het
Lin54 C A 5: 100,598,546 (GRCm39) R593L probably damaging Het
Lrp1 T A 10: 127,410,246 (GRCm39) N1500I probably damaging Het
Lvrn A C 18: 46,999,494 (GRCm39) S287R probably benign Het
Mab21l4 T C 1: 93,087,568 (GRCm39) E95G possibly damaging Het
Madd G A 2: 91,006,026 (GRCm39) P390S probably damaging Het
Mapk8ip3 C A 17: 25,118,124 (GRCm39) R1281L probably damaging Het
Masp1 T A 16: 23,271,698 (GRCm39) T618S probably benign Het
Mgat5 A G 1: 127,248,445 (GRCm39) T116A probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrpl39 A G 16: 84,527,359 (GRCm39) F176S probably damaging Het
Myt1l T C 12: 29,943,441 (GRCm39) I953T unknown Het
Nedd4l A G 18: 65,343,400 (GRCm39) H820R probably damaging Het
Nxpe3 A T 16: 55,664,855 (GRCm39) V455D probably damaging Het
Olfm4 T C 14: 80,243,747 (GRCm39) F105S probably damaging Het
Or10ak8 C T 4: 118,773,851 (GRCm39) R271Q probably benign Het
Patz1 A G 11: 3,240,720 (GRCm39) N36S probably benign Het
Peg3 T A 7: 6,714,723 (GRCm39) K166N probably damaging Het
Pes1 T A 11: 3,926,118 (GRCm39) D302E probably benign Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plekhh3 G A 11: 101,054,972 (GRCm39) T627M unknown Het
Plxnd1 C T 6: 115,940,274 (GRCm39) R1370Q possibly damaging Het
Rnf20 T C 4: 49,638,751 (GRCm39) V191A probably benign Het
Scn8a A T 15: 100,911,172 (GRCm39) K864M probably damaging Het
Sema3c T C 5: 17,919,452 (GRCm39) probably null Het
Slc24a4 C T 12: 102,097,779 (GRCm39) T30I probably benign Het
Slc27a2 A G 2: 126,420,904 (GRCm39) D465G probably damaging Het
Snrnp48 T C 13: 38,393,920 (GRCm39) M75T probably benign Het
Srgap2 A G 1: 131,272,164 (GRCm39) S41P Het
St3gal5 A G 6: 72,130,580 (GRCm39) T391A probably benign Het
Stkld1 T C 2: 26,843,297 (GRCm39) L628P possibly damaging Het
Tbc1d1 T A 5: 64,502,701 (GRCm39) M1074K probably benign Het
Tent2 G T 13: 93,322,821 (GRCm39) Q43K probably benign Het
Tpsb2 T A 17: 25,586,077 (GRCm39) Y98* probably null Het
Trav6d-3 G A 14: 52,964,144 (GRCm39) D36N probably benign Het
Trim16 A G 11: 62,731,644 (GRCm39) Y505C probably damaging Het
Ttpal A G 2: 163,457,458 (GRCm39) D310G probably benign Het
Ubox5 A G 2: 130,441,835 (GRCm39) I284T probably damaging Het
Vmn2r45 T A 7: 8,478,457 (GRCm39) probably null Het
Vmn2r67 T C 7: 84,804,941 (GRCm39) D57G probably damaging Het
Wdfy4 T C 14: 32,855,428 (GRCm39) T729A Het
Wdr81 A T 11: 75,344,349 (GRCm39) M306K probably benign Het
Zfp62 A G 11: 49,106,542 (GRCm39) D211G probably damaging Het
Zfyve16 T C 13: 92,636,763 (GRCm39) K1316E probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATAATCGAACACATGCCTCC -3'
(R):5'- ACTTTGGAAGAGAATGCCCC -3'

Sequencing Primer
(F):5'- GAACACATGCCTCCGTGAGTC -3'
(R):5'- CTGGAACTCACTTTGTAGCCAGG -3'
Posted On 2022-08-09