Incidental Mutation 'R9599:Cse1l'
ID 723436
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166941466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 780 (N780S)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: N780S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: N780S

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: N467S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: N467S

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: N724S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: N724S

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,506 N1152S probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2310007B03Rik T C 1: 93,159,846 E95G possibly damaging Het
Abcb6 A T 1: 75,174,728 Y518N possibly damaging Het
Actr2 G A 11: 20,080,745 P168S probably damaging Het
Adam12 A G 7: 133,964,725 V332A probably damaging Het
Adam23 T C 1: 63,581,200 I805T probably benign Het
Adar A G 3: 89,747,209 T883A probably benign Het
Aldh3a1 A G 11: 61,217,086 T319A probably damaging Het
Apcdd1 T A 18: 62,950,198 probably null Het
Arhgef18 C A 8: 3,432,718 A141E possibly damaging Het
Bub3 A G 7: 131,568,699 T317A probably benign Het
Ccdc102a A G 8: 94,913,273 L131P probably damaging Het
Ccdc60 C A 5: 116,131,206 D452Y probably damaging Het
Ccdc66 T C 14: 27,497,424 E125G probably damaging Het
Ccdc68 A G 18: 69,960,421 E233G probably damaging Het
Cep192 A G 18: 67,835,454 D973G probably benign Het
Cox5b T A 1: 36,691,678 M31K probably benign Het
Cyfip1 T C 7: 55,913,529 probably null Het
Cyp1a1 C T 9: 57,700,487 P133S probably benign Het
Dcp1a A G 14: 30,519,540 M436V probably benign Het
Dcst1 G T 3: 89,357,768 Y258* probably null Het
Dhx30 T C 9: 110,085,450 E993G possibly damaging Het
Disc1 A T 8: 125,087,522 M42L possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Erbb2 A T 11: 98,427,390 D484V probably benign Het
Fam189b A G 3: 89,186,792 D304G possibly damaging Het
Fxr2 A G 11: 69,652,643 N657D probably benign Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gdap2 A T 3: 100,170,948 N76I probably damaging Het
Gm20939 A G 17: 94,877,238 Y438C probably damaging Het
Gsdma2 A G 11: 98,649,633 E126G possibly damaging Het
Gsg1 T G 6: 135,240,100 H246P probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ighv1-62-1 T C 12: 115,386,981 Q22R possibly damaging Het
Kcng3 A T 17: 83,587,782 F418L probably benign Het
Lin54 C A 5: 100,450,687 R593L probably damaging Het
Lrp1 T A 10: 127,574,377 N1500I probably damaging Het
Lvrn A C 18: 46,866,427 S287R probably benign Het
Madd G A 2: 91,175,681 P390S probably damaging Het
Mapk8ip3 C A 17: 24,899,150 R1281L probably damaging Het
Masp1 T A 16: 23,452,948 T618S probably benign Het
Mgat5 A G 1: 127,320,708 T116A probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl39 A G 16: 84,730,471 F176S probably damaging Het
Myt1l T C 12: 29,893,442 I953T unknown Het
Nedd4l A G 18: 65,210,329 H820R probably damaging Het
Nxpe3 A T 16: 55,844,492 V455D probably damaging Het
Olfm4 T C 14: 80,006,307 F105S probably damaging Het
Olfr1329 C T 4: 118,916,654 R271Q probably benign Het
Papd4 G T 13: 93,186,313 Q43K probably benign Het
Patz1 A G 11: 3,290,720 N36S probably benign Het
Peg3 T A 7: 6,711,724 K166N probably damaging Het
Pes1 T A 11: 3,976,118 D302E probably benign Het
Plekhh3 G A 11: 101,164,146 T627M unknown Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Rnf20 T C 4: 49,638,751 V191A probably benign Het
Scn8a A T 15: 101,013,291 K864M probably damaging Het
Sema3c T C 5: 17,714,454 probably null Het
Slc24a4 C T 12: 102,131,520 T30I probably benign Het
Slc27a2 A G 2: 126,578,984 D465G probably damaging Het
Snrnp48 T C 13: 38,209,944 M75T probably benign Het
Srgap2 A G 1: 131,344,426 S41P Het
St3gal5 A G 6: 72,153,596 T391A probably benign Het
Stkld1 T C 2: 26,953,285 L628P possibly damaging Het
Tbc1d1 T A 5: 64,345,358 M1074K probably benign Het
Tpsb2 T A 17: 25,367,103 Y98* probably null Het
Trav6d-3 G A 14: 52,726,687 D36N probably benign Het
Trim16 A G 11: 62,840,818 Y505C probably damaging Het
Ttpal A G 2: 163,615,538 D310G probably benign Het
Ubox5 A G 2: 130,599,915 I284T probably damaging Het
Vmn2r45 T A 7: 8,475,458 probably null Het
Vmn2r67 T C 7: 85,155,733 D57G probably damaging Het
Wdfy4 T C 14: 33,133,471 T729A Het
Wdr81 A T 11: 75,453,523 M306K probably benign Het
Zfp62 A G 11: 49,215,715 D211G probably damaging Het
Zfyve16 T C 13: 92,500,255 K1316E probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATAATCGAACACATGCCTCC -3'
(R):5'- ACTTTGGAAGAGAATGCCCC -3'

Sequencing Primer
(F):5'- GAACACATGCCTCCGTGAGTC -3'
(R):5'- CTGGAACTCACTTTGTAGCCAGG -3'
Posted On 2022-08-09