Incidental Mutation 'R9599:Trav6d-3'
ID 723484
Institutional Source Beutler Lab
Gene Symbol Trav6d-3
Ensembl Gene ENSMUSG00000096600
Gene Name T cell receptor alpha variable 6D-3
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # R9599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52725299-52726917 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52726687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 36 (D36N)
Ref Sequence ENSEMBL: ENSMUSP00000137760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181483] [ENSMUST00000184883]
AlphaFold A0A075B6D3
Predicted Effect probably benign
Transcript: ENSMUST00000181483
AA Change: D36N

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137760
Gene: ENSMUSG00000096600
AA Change: D36N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set 21 112 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184883
AA Change: D26N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139137
Gene: ENSMUSG00000096600
AA Change: D26N

DomainStartEndE-ValueType
Pfam:V-set 11 102 3.8e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,506 N1152S probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2310007B03Rik T C 1: 93,159,846 E95G possibly damaging Het
Abcb6 A T 1: 75,174,728 Y518N possibly damaging Het
Actr2 G A 11: 20,080,745 P168S probably damaging Het
Adam12 A G 7: 133,964,725 V332A probably damaging Het
Adam23 T C 1: 63,581,200 I805T probably benign Het
Adar A G 3: 89,747,209 T883A probably benign Het
Aldh3a1 A G 11: 61,217,086 T319A probably damaging Het
Apcdd1 T A 18: 62,950,198 probably null Het
Arhgef18 C A 8: 3,432,718 A141E possibly damaging Het
Bub3 A G 7: 131,568,699 T317A probably benign Het
Ccdc102a A G 8: 94,913,273 L131P probably damaging Het
Ccdc60 C A 5: 116,131,206 D452Y probably damaging Het
Ccdc66 T C 14: 27,497,424 E125G probably damaging Het
Ccdc68 A G 18: 69,960,421 E233G probably damaging Het
Cep192 A G 18: 67,835,454 D973G probably benign Het
Cox5b T A 1: 36,691,678 M31K probably benign Het
Cse1l A G 2: 166,941,466 N780S probably benign Het
Cyfip1 T C 7: 55,913,529 probably null Het
Cyp1a1 C T 9: 57,700,487 P133S probably benign Het
Dcp1a A G 14: 30,519,540 M436V probably benign Het
Dcst1 G T 3: 89,357,768 Y258* probably null Het
Dhx30 T C 9: 110,085,450 E993G possibly damaging Het
Disc1 A T 8: 125,087,522 M42L possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Erbb2 A T 11: 98,427,390 D484V probably benign Het
Fam189b A G 3: 89,186,792 D304G possibly damaging Het
Fxr2 A G 11: 69,652,643 N657D probably benign Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gdap2 A T 3: 100,170,948 N76I probably damaging Het
Gm20939 A G 17: 94,877,238 Y438C probably damaging Het
Gsdma2 A G 11: 98,649,633 E126G possibly damaging Het
Gsg1 T G 6: 135,240,100 H246P probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ighv1-62-1 T C 12: 115,386,981 Q22R possibly damaging Het
Kcng3 A T 17: 83,587,782 F418L probably benign Het
Lin54 C A 5: 100,450,687 R593L probably damaging Het
Lrp1 T A 10: 127,574,377 N1500I probably damaging Het
Lvrn A C 18: 46,866,427 S287R probably benign Het
Madd G A 2: 91,175,681 P390S probably damaging Het
Mapk8ip3 C A 17: 24,899,150 R1281L probably damaging Het
Masp1 T A 16: 23,452,948 T618S probably benign Het
Mgat5 A G 1: 127,320,708 T116A probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl39 A G 16: 84,730,471 F176S probably damaging Het
Myt1l T C 12: 29,893,442 I953T unknown Het
Nedd4l A G 18: 65,210,329 H820R probably damaging Het
Nxpe3 A T 16: 55,844,492 V455D probably damaging Het
Olfm4 T C 14: 80,006,307 F105S probably damaging Het
Olfr1329 C T 4: 118,916,654 R271Q probably benign Het
Papd4 G T 13: 93,186,313 Q43K probably benign Het
Patz1 A G 11: 3,290,720 N36S probably benign Het
Peg3 T A 7: 6,711,724 K166N probably damaging Het
Pes1 T A 11: 3,976,118 D302E probably benign Het
Plekhh3 G A 11: 101,164,146 T627M unknown Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Rnf20 T C 4: 49,638,751 V191A probably benign Het
Scn8a A T 15: 101,013,291 K864M probably damaging Het
Sema3c T C 5: 17,714,454 probably null Het
Slc24a4 C T 12: 102,131,520 T30I probably benign Het
Slc27a2 A G 2: 126,578,984 D465G probably damaging Het
Snrnp48 T C 13: 38,209,944 M75T probably benign Het
Srgap2 A G 1: 131,344,426 S41P Het
St3gal5 A G 6: 72,153,596 T391A probably benign Het
Stkld1 T C 2: 26,953,285 L628P possibly damaging Het
Tbc1d1 T A 5: 64,345,358 M1074K probably benign Het
Tpsb2 T A 17: 25,367,103 Y98* probably null Het
Trim16 A G 11: 62,840,818 Y505C probably damaging Het
Ttpal A G 2: 163,615,538 D310G probably benign Het
Ubox5 A G 2: 130,599,915 I284T probably damaging Het
Vmn2r45 T A 7: 8,475,458 probably null Het
Vmn2r67 T C 7: 85,155,733 D57G probably damaging Het
Wdfy4 T C 14: 33,133,471 T729A Het
Wdr81 A T 11: 75,453,523 M306K probably benign Het
Zfp62 A G 11: 49,215,715 D211G probably damaging Het
Zfyve16 T C 13: 92,500,255 K1316E probably damaging Het
Other mutations in Trav6d-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
teed_off UTSW 14 52725342 missense probably damaging 1.00
R2445:Trav6d-3 UTSW 14 52726828 missense probably damaging 1.00
R4173:Trav6d-3 UTSW 14 52725349 missense probably benign 0.00
R7215:Trav6d-3 UTSW 14 52725342 missense probably damaging 1.00
R9132:Trav6d-3 UTSW 14 52726753 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCAGGGCAACATTTGGAAC -3'
(R):5'- ACTGTGTCACTCATAGCACAG -3'

Sequencing Primer
(F):5'- CAGGGCAACATTTGGAACAGAAATAC -3'
(R):5'- CTGTGTCACTCATAGCACAGTAGTAC -3'
Posted On 2022-08-09