Incidental Mutation 'R9599:Masp1'
ID 723487
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R9599 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23271698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 618 (T618S)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
AlphaFold P98064
Predicted Effect probably benign
Transcript: ENSMUST00000089883
AA Change: T618S

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: T618S

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,774,267 (GRCm39) N1152S probably benign Het
Abcb6 A T 1: 75,151,372 (GRCm39) Y518N possibly damaging Het
Actr2 G A 11: 20,030,745 (GRCm39) P168S probably damaging Het
Adam12 A G 7: 133,566,454 (GRCm39) V332A probably damaging Het
Adam23 T C 1: 63,620,359 (GRCm39) I805T probably benign Het
Adar A G 3: 89,654,516 (GRCm39) T883A probably benign Het
Aldh3a1 A G 11: 61,107,912 (GRCm39) T319A probably damaging Het
Apcdd1 T A 18: 63,083,269 (GRCm39) probably null Het
Arhgef18 C A 8: 3,482,718 (GRCm39) A141E possibly damaging Het
Bub3 A G 7: 131,170,428 (GRCm39) T317A probably benign Het
Ccdc102a A G 8: 95,639,901 (GRCm39) L131P probably damaging Het
Ccdc60 C A 5: 116,269,265 (GRCm39) D452Y probably damaging Het
Ccdc66 T C 14: 27,219,381 (GRCm39) E125G probably damaging Het
Ccdc68 A G 18: 70,093,492 (GRCm39) E233G probably damaging Het
Cep192 A G 18: 67,968,525 (GRCm39) D973G probably benign Het
Cox5b T A 1: 36,730,759 (GRCm39) M31K probably benign Het
Cse1l A G 2: 166,783,386 (GRCm39) N780S probably benign Het
Cyfip1 T C 7: 55,563,277 (GRCm39) probably null Het
Cyp1a1 C T 9: 57,607,770 (GRCm39) P133S probably benign Het
Dcp1a A G 14: 30,241,497 (GRCm39) M436V probably benign Het
Dcst1 G T 3: 89,265,075 (GRCm39) Y258* probably null Het
Dhx30 T C 9: 109,914,518 (GRCm39) E993G possibly damaging Het
Disc1 A T 8: 125,814,261 (GRCm39) M42L possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Entrep3 A G 3: 89,094,099 (GRCm39) D304G possibly damaging Het
Erbb2 A T 11: 98,318,216 (GRCm39) D484V probably benign Het
Fxr2 A G 11: 69,543,469 (GRCm39) N657D probably benign Het
Gbx2 T C 1: 89,856,635 (GRCm39) T252A probably damaging Het
Gdap2 A T 3: 100,078,264 (GRCm39) N76I probably damaging Het
Gm20939 A G 17: 95,184,666 (GRCm39) Y438C probably damaging Het
Gsdma2 A G 11: 98,540,459 (GRCm39) E126G possibly damaging Het
Gsg1 T G 6: 135,217,098 (GRCm39) H246P probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Ighv1-62-1 T C 12: 115,350,601 (GRCm39) Q22R possibly damaging Het
Kcng3 A T 17: 83,895,211 (GRCm39) F418L probably benign Het
Lin54 C A 5: 100,598,546 (GRCm39) R593L probably damaging Het
Lrp1 T A 10: 127,410,246 (GRCm39) N1500I probably damaging Het
Lvrn A C 18: 46,999,494 (GRCm39) S287R probably benign Het
Mab21l4 T C 1: 93,087,568 (GRCm39) E95G possibly damaging Het
Madd G A 2: 91,006,026 (GRCm39) P390S probably damaging Het
Mapk8ip3 C A 17: 25,118,124 (GRCm39) R1281L probably damaging Het
Mgat5 A G 1: 127,248,445 (GRCm39) T116A probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrpl39 A G 16: 84,527,359 (GRCm39) F176S probably damaging Het
Myt1l T C 12: 29,943,441 (GRCm39) I953T unknown Het
Nedd4l A G 18: 65,343,400 (GRCm39) H820R probably damaging Het
Nxpe3 A T 16: 55,664,855 (GRCm39) V455D probably damaging Het
Olfm4 T C 14: 80,243,747 (GRCm39) F105S probably damaging Het
Or10ak8 C T 4: 118,773,851 (GRCm39) R271Q probably benign Het
Patz1 A G 11: 3,240,720 (GRCm39) N36S probably benign Het
Peg3 T A 7: 6,714,723 (GRCm39) K166N probably damaging Het
Pes1 T A 11: 3,926,118 (GRCm39) D302E probably benign Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plekhh3 G A 11: 101,054,972 (GRCm39) T627M unknown Het
Plxnd1 C T 6: 115,940,274 (GRCm39) R1370Q possibly damaging Het
Rnf20 T C 4: 49,638,751 (GRCm39) V191A probably benign Het
Scn8a A T 15: 100,911,172 (GRCm39) K864M probably damaging Het
Sema3c T C 5: 17,919,452 (GRCm39) probably null Het
Slc24a4 C T 12: 102,097,779 (GRCm39) T30I probably benign Het
Slc27a2 A G 2: 126,420,904 (GRCm39) D465G probably damaging Het
Snrnp48 T C 13: 38,393,920 (GRCm39) M75T probably benign Het
Srgap2 A G 1: 131,272,164 (GRCm39) S41P Het
St3gal5 A G 6: 72,130,580 (GRCm39) T391A probably benign Het
Stkld1 T C 2: 26,843,297 (GRCm39) L628P possibly damaging Het
Tbc1d1 T A 5: 64,502,701 (GRCm39) M1074K probably benign Het
Tent2 G T 13: 93,322,821 (GRCm39) Q43K probably benign Het
Tpsb2 T A 17: 25,586,077 (GRCm39) Y98* probably null Het
Trav6d-3 G A 14: 52,964,144 (GRCm39) D36N probably benign Het
Trim16 A G 11: 62,731,644 (GRCm39) Y505C probably damaging Het
Ttpal A G 2: 163,457,458 (GRCm39) D310G probably benign Het
Ubox5 A G 2: 130,441,835 (GRCm39) I284T probably damaging Het
Vmn2r45 T A 7: 8,478,457 (GRCm39) probably null Het
Vmn2r67 T C 7: 84,804,941 (GRCm39) D57G probably damaging Het
Wdfy4 T C 14: 32,855,428 (GRCm39) T729A Het
Wdr81 A T 11: 75,344,349 (GRCm39) M306K probably benign Het
Zfp62 A G 11: 49,106,542 (GRCm39) D211G probably damaging Het
Zfyve16 T C 13: 92,636,763 (GRCm39) K1316E probably damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5562:Masp1 UTSW 16 23,283,917 (GRCm39) splice site probably null
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23,273,675 (GRCm39) missense probably benign 0.01
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7069:Masp1 UTSW 16 23,271,205 (GRCm39) missense probably benign 0.20
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23,295,068 (GRCm39) missense probably benign 0.01
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGAAAGGGCTGGTTCAG -3'
(R):5'- GACACGGTGTTTCTATATGCTGTC -3'

Sequencing Primer
(F):5'- GGATGGCAAAAGTTCTATATTCCCCC -3'
(R):5'- AAAGCTGCTTTACCAGGGTC -3'
Posted On 2022-08-09