Incidental Mutation 'R9119:Plxnd1'
ID 723510
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9119 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 115955871 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably benign
Transcript: ENSMUST00000015511
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
4932415D10Rik T C 10: 82,295,719 T486A probably benign Het
Aass A T 6: 23,094,001 M517K probably benign Het
Abcc4 A G 14: 118,631,030 V245A probably benign Het
Adgrv1 A G 13: 81,510,876 V2783A probably damaging Het
Anxa3 T A 5: 96,828,698 I181N Het
Ap4m1 T A 5: 138,176,041 probably benign Het
C1ql1 T A 11: 102,946,053 K137* probably null Het
Camkmt T A 17: 85,096,560 L70Q probably damaging Het
Ceacam18 T C 7: 43,639,485 L220P probably benign Het
Celsr2 C T 3: 108,401,972 A1656T possibly damaging Het
Dnah6 T C 6: 73,060,203 N3352S possibly damaging Het
Fbxo40 C A 16: 36,966,095 R704L probably damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Gas2l3 T C 10: 89,413,457 T600A possibly damaging Het
Ggh T A 4: 20,057,955 M172K probably damaging Het
Gm10184 T C 17: 89,910,193 K42E probably damaging Het
Gpr137 G A 19: 6,938,443 T373I probably benign Het
Mtnr1a G A 8: 45,087,966 M321I probably benign Het
Nebl T G 2: 17,400,559 N383T probably damaging Het
Nob1 A G 8: 107,416,144 S302P probably damaging Het
Ofcc1 A T 13: 40,180,540 H358Q probably benign Het
Olfr1414 G T 1: 92,511,182 T282K probably damaging Het
Pkd1l1 G A 11: 8,879,107 T1495I Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb4 G A 2: 135,967,952 E609K probably damaging Het
Prdm2 G A 4: 143,131,879 Q1614* probably null Het
Psg21 T G 7: 18,647,484 K378T probably benign Het
Ptprh T A 7: 4,552,713 N749I probably benign Het
Ric8b T G 10: 84,947,470 V64G possibly damaging Het
Sbf2 T C 7: 110,312,085 T1793A possibly damaging Het
Scgb1c1 A G 7: 140,846,222 H77R probably null Het
Sfswap C A 5: 129,514,765 T282N probably benign Het
Sorcs3 A T 19: 48,653,994 Y362F possibly damaging Het
Tpm4 A G 8: 72,138,681 N76D probably benign Het
Tpr T A 1: 150,404,002 L294Q probably damaging Het
Ttc3 C T 16: 94,392,091 T237I probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ugt2a2 A G 5: 87,462,975 V334A probably damaging Het
Usp38 A T 8: 80,984,599 F936I probably damaging Het
Utp14b A G 1: 78,665,308 K308E probably damaging Het
Vmn2r19 C T 6: 123,315,568 P190S possibly damaging Het
Zbbx T C 3: 75,078,590 E385G probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCCCAAGTGAGAGATGTG -3'
(R):5'- TCAACACAAACGTGGCCATGG -3'

Sequencing Primer
(F):5'- CCAAGTGGAGGCCAAGTG -3'
(R):5'- CAAACGTGGCCATGGCTGAG -3'
Posted On 2022-08-10