Incidental Mutation 'R9311:Vmn2r88'
ID 723557
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r3, V2r13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock # R9311 (G1)
Quality Score 72.0074
Status Validated
Chromosome 14
Chromosomal Location 51410819-51419527 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 51413046 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 72 (A72G)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: A72G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
AA Change: A47G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: A47G

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: A72G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik T G 3: 92,533,090 Q14P unknown Het
5430419D17Rik A T 7: 131,257,761 D1137V unknown Het
A4gnt T C 9: 99,613,763 I84T possibly damaging Het
Adad2 G T 8: 119,615,247 R268L probably damaging Het
Agxt2 A T 15: 10,380,647 N208I probably damaging Het
Brsk1 G T 7: 4,706,723 probably null Het
Cd40 A T 2: 165,070,747 Q235L possibly damaging Het
Cln6 T C 9: 62,850,618 Y220H probably damaging Het
Cngb1 A T 8: 95,284,166 probably null Het
Cpne1 A T 2: 156,077,803 V277E probably damaging Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cyp4f15 A G 17: 32,686,165 T41A probably benign Het
Dab1 T C 4: 104,512,266 probably null Het
Eif4e1b C A 13: 54,784,519 H56N probably benign Het
Elp3 A T 14: 65,586,339 D78E probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Gabarap T A 11: 69,991,723 V4E probably benign Het
Gm5105 T A 3: 138,049,657 D56V unknown Het
Gosr2 G T 11: 103,683,867 H134Q probably damaging Het
Ifi204 A G 1: 173,761,649 V72A possibly damaging Het
Irx1 A G 13: 71,959,297 V422A probably benign Het
Kcne4 C A 1: 78,818,107 D157E probably benign Het
Kctd13 A G 7: 126,942,173 N195S probably damaging Het
Kirrel A G 3: 87,097,816 V75A probably benign Het
Klkb1 T C 8: 45,269,946 T625A probably benign Het
Lama5 A G 2: 180,196,482 probably null Het
Lifr A G 15: 7,178,937 I599V possibly damaging Het
Lin52 A T 12: 84,529,696 E101V probably damaging Het
Liph C T 16: 21,956,163 R428Q probably damaging Het
Liph T C 16: 21,983,930 I130V probably benign Het
Lrrc4c A C 2: 97,630,735 I569L possibly damaging Het
Mnat1 G A 12: 73,168,142 V78I probably benign Het
Msln C T 17: 25,753,016 D76N probably benign Het
Myh7b A G 2: 155,621,333 H495R probably damaging Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nfu1 T C 6: 87,009,944 V15A probably benign Het
Nphp4 T C 4: 152,524,257 S441P probably damaging Het
Nuak1 T C 10: 84,378,226 probably null Het
Olfr153 A G 2: 87,532,014 probably benign Het
Olfr197 A T 16: 59,185,743 C247S unknown Het
Olfr352 A T 2: 36,870,393 I276F probably damaging Het
Olfr918 A G 9: 38,672,629 S272P probably damaging Het
Palld A G 8: 61,525,155 V1109A unknown Het
Pik3c3 G A 18: 30,312,613 R551H probably benign Het
Plcb1 G A 2: 135,347,465 V838I probably benign Het
Plppr4 G T 3: 117,325,869 T297K probably damaging Het
Ptprd A G 4: 76,133,083 I67T probably benign Het
Rb1cc1 T A 1: 6,240,315 N312K probably damaging Het
Sh3glb1 A C 3: 144,691,898 probably null Het
Siglec1 C T 2: 131,074,093 C1283Y probably damaging Het
Spns1 T C 7: 126,373,823 I204V probably damaging Het
Supt6 T C 11: 78,225,458 Y693C probably damaging Het
Taar9 A G 10: 24,109,254 V94A probably damaging Het
Tchp T C 5: 114,708,816 S55P probably benign Het
Tmem132b A G 5: 125,785,965 H678R possibly damaging Het
Tnr G C 1: 159,850,093 G16A probably benign Het
Top3b T C 16: 16,882,699 probably null Het
Tpmt A G 13: 47,032,416 probably null Het
Treh G A 9: 44,681,358 V87I probably benign Het
Ttc4 T C 4: 106,678,766 D33G probably benign Het
Usp47 A G 7: 112,104,050 D1171G probably benign Het
Vmn2r61 G T 7: 42,300,668 L837F possibly damaging Het
Vmn2r86 T A 10: 130,452,571 N354Y probably damaging Het
Zscan4b C A 7: 10,902,023 V126F probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51413167 missense
R9038:Vmn2r88 UTSW 14 51414033 missense
R9063:Vmn2r88 UTSW 14 51410872 start gained probably benign
R9382:Vmn2r88 UTSW 14 51418740 missense
R9483:Vmn2r88 UTSW 14 51411184 missense
R9602:Vmn2r88 UTSW 14 51413732 missense
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- GTGCTCAGACAACACTTAAAGG -3'
(R):5'- GTCCTGTAAGACCTATGGCAC -3'

Sequencing Primer
(F):5'- ACTTGATATGTACAAGACCCTAAAGG -3'
(R):5'- TGGCACATGAATCATCTAAATAACAG -3'
Posted On 2022-08-26