Incidental Mutation 'R9311:Vmn2r88'
ID 723557
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9311 (G1)
Quality Score 72.0074
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 51650503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 72 (A72G)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: A72G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
AA Change: A47G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: A47G

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: A72G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,495,816 (GRCm39) I84T possibly damaging Het
Adad2 G T 8: 120,341,986 (GRCm39) R268L probably damaging Het
Agxt2 A T 15: 10,380,733 (GRCm39) N208I probably damaging Het
Brsk1 G T 7: 4,709,722 (GRCm39) probably null Het
Cd40 A T 2: 164,912,667 (GRCm39) Q235L possibly damaging Het
Cdcp3 A T 7: 130,859,490 (GRCm39) D1137V unknown Het
Cln6 T C 9: 62,757,900 (GRCm39) Y220H probably damaging Het
Cngb1 A T 8: 96,010,794 (GRCm39) probably null Het
Cpne1 A T 2: 155,919,723 (GRCm39) V277E probably damaging Het
Csf2rb2 C T 15: 78,176,735 (GRCm39) probably null Het
Cyp4f15 A G 17: 32,905,139 (GRCm39) T41A probably benign Het
Dab1 T C 4: 104,369,463 (GRCm39) probably null Het
Eif4e1b C A 13: 54,932,332 (GRCm39) H56N probably benign Het
Elp3 A T 14: 65,823,788 (GRCm39) D78E probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Gabarap T A 11: 69,882,549 (GRCm39) V4E probably benign Het
Gm5105 T A 3: 137,755,418 (GRCm39) D56V unknown Het
Gosr2 G T 11: 103,574,693 (GRCm39) H134Q probably damaging Het
Ifi204 A G 1: 173,589,215 (GRCm39) V72A possibly damaging Het
Irx1 A G 13: 72,107,416 (GRCm39) V422A probably benign Het
Kcne4 C A 1: 78,795,824 (GRCm39) D157E probably benign Het
Kctd13 A G 7: 126,541,345 (GRCm39) N195S probably damaging Het
Kirrel1 A G 3: 87,005,123 (GRCm39) V75A probably benign Het
Klkb1 T C 8: 45,722,983 (GRCm39) T625A probably benign Het
Lama5 A G 2: 179,838,275 (GRCm39) probably null Het
Lifr A G 15: 7,208,418 (GRCm39) I599V possibly damaging Het
Lin52 A T 12: 84,576,470 (GRCm39) E101V probably damaging Het
Liph T C 16: 21,802,680 (GRCm39) I130V probably benign Het
Liph C T 16: 21,774,913 (GRCm39) R428Q probably damaging Het
Lrrc4c A C 2: 97,461,080 (GRCm39) I569L possibly damaging Het
Mnat1 G A 12: 73,214,916 (GRCm39) V78I probably benign Het
Msln C T 17: 25,971,990 (GRCm39) D76N probably benign Het
Myh7b A G 2: 155,463,253 (GRCm39) H495R probably damaging Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nfu1 T C 6: 86,986,926 (GRCm39) V15A probably benign Het
Nphp4 T C 4: 152,608,714 (GRCm39) S441P probably damaging Het
Nuak1 T C 10: 84,214,090 (GRCm39) probably null Het
Or1j20 A T 2: 36,760,405 (GRCm39) I276F probably damaging Het
Or5h27 A T 16: 59,006,106 (GRCm39) C247S unknown Het
Or5w22 A G 2: 87,362,358 (GRCm39) probably benign Het
Or8b3b A G 9: 38,583,925 (GRCm39) S272P probably damaging Het
Palld A G 8: 61,978,189 (GRCm39) V1109A unknown Het
Pik3c3 G A 18: 30,445,666 (GRCm39) R551H probably benign Het
Plcb1 G A 2: 135,189,385 (GRCm39) V838I probably benign Het
Plppr4 G T 3: 117,119,518 (GRCm39) T297K probably damaging Het
Ptprd A G 4: 76,051,320 (GRCm39) I67T probably benign Het
Rb1cc1 T A 1: 6,310,539 (GRCm39) N312K probably damaging Het
Sh3glb1 A C 3: 144,397,659 (GRCm39) probably null Het
Siglec1 C T 2: 130,916,013 (GRCm39) C1283Y probably damaging Het
Spns1 T C 7: 125,972,995 (GRCm39) I204V probably damaging Het
Sprr5 T G 3: 92,440,397 (GRCm39) Q14P unknown Het
Supt6 T C 11: 78,116,284 (GRCm39) Y693C probably damaging Het
Taar9 A G 10: 23,985,152 (GRCm39) V94A probably damaging Het
Tchp T C 5: 114,846,877 (GRCm39) S55P probably benign Het
Tmem132b A G 5: 125,863,029 (GRCm39) H678R possibly damaging Het
Tnr G C 1: 159,677,663 (GRCm39) G16A probably benign Het
Top3b T C 16: 16,700,563 (GRCm39) probably null Het
Tpmt A G 13: 47,185,892 (GRCm39) probably null Het
Treh G A 9: 44,592,655 (GRCm39) V87I probably benign Het
Ttc4 T C 4: 106,535,963 (GRCm39) D33G probably benign Het
Usp47 A G 7: 111,703,257 (GRCm39) D1171G probably benign Het
Vmn2r61 G T 7: 41,950,092 (GRCm39) L837F possibly damaging Het
Vmn2r86 T A 10: 130,288,440 (GRCm39) N354Y probably damaging Het
Zscan4b C A 7: 10,635,950 (GRCm39) V126F probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51,656,007 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51,650,665 (GRCm39) missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6103:Vmn2r88 UTSW 14 51,652,826 (GRCm39) missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7552:Vmn2r88 UTSW 14 51,648,315 (GRCm39) splice site probably null
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8859:Vmn2r88 UTSW 14 51,656,263 (GRCm39) missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GTGCTCAGACAACACTTAAAGG -3'
(R):5'- GTCCTGTAAGACCTATGGCAC -3'

Sequencing Primer
(F):5'- ACTTGATATGTACAAGACCCTAAAGG -3'
(R):5'- TGGCACATGAATCATCTAAATAACAG -3'
Posted On 2022-08-26