Incidental Mutation 'R9279:Or1e16'
ID 723560
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R9279 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73279789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 21 (P21L)
Ref Sequence ENSEMBL: ENSMUSP00000145769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably benign
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
AA Change: P21L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr7a5 A T 4: 139,044,079 (GRCm39) H225L possibly damaging Het
Arhgap32 C A 9: 32,168,655 (GRCm39) H879Q probably benign Het
Axin2 A G 11: 108,833,128 (GRCm39) I438V possibly damaging Het
Btbd18 T A 2: 84,491,920 (GRCm39) C34S probably damaging Het
Carns1 G T 19: 4,216,256 (GRCm39) T642N possibly damaging Het
Casp8 T C 1: 58,883,542 (GRCm39) I283T probably benign Het
Ccdc136 T A 6: 29,421,982 (GRCm39) probably benign Het
Ccnk C A 12: 108,161,946 (GRCm39) Q284K unknown Het
Ceacam12 T A 7: 17,801,177 (GRCm39) L52H probably damaging Het
Cit G A 5: 116,065,970 (GRCm39) D540N probably damaging Het
Cntnap1 T C 11: 101,072,121 (GRCm39) V458A probably damaging Het
Col6a5 T A 9: 105,758,976 (GRCm39) I2077F probably damaging Het
Dnah2 T C 11: 69,409,104 (GRCm39) K425E probably benign Het
Eya2 A G 2: 165,529,631 (GRCm39) S125G probably benign Het
Gabrg1 T G 5: 70,934,599 (GRCm39) M260L probably benign Het
Greb1 T C 12: 16,732,153 (GRCm39) S1603G probably damaging Het
Isx A G 8: 75,600,434 (GRCm39) T56A probably benign Het
Kif2b A T 11: 91,467,975 (GRCm39) S103T probably benign Het
Krtap26-1 T C 16: 88,444,342 (GRCm39) H93R probably benign Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mdm4 G A 1: 132,924,416 (GRCm39) T236M probably damaging Het
Mgat5 T A 1: 127,325,348 (GRCm39) L405Q probably damaging Het
Msantd1 A G 5: 35,080,885 (GRCm39) I272V probably benign Het
Ocstamp A G 2: 165,237,768 (GRCm39) *499Q probably null Het
Or11h6 A G 14: 50,880,493 (GRCm39) K252E possibly damaging Het
Or2n1d G A 17: 38,646,414 (GRCm39) R122Q probably damaging Het
Or4c100 A G 2: 88,356,211 (GRCm39) M95V probably benign Het
Or5b12 A T 19: 12,897,309 (GRCm39) Y121* probably null Het
Pcdh15 T A 10: 74,461,756 (GRCm39) probably benign Het
Pkdrej C T 15: 85,700,834 (GRCm39) G1701S probably damaging Het
Ppp1r9a A G 6: 5,113,757 (GRCm39) T754A probably damaging Het
Prss8 C A 7: 127,527,082 (GRCm39) Q55H probably damaging Het
Psg20 G T 7: 18,416,670 (GRCm39) R149S probably benign Het
Ptprz1 T G 6: 23,002,444 (GRCm39) N1511K probably benign Het
Rbbp8nl C T 2: 179,920,894 (GRCm39) probably null Het
Sgk2 A G 2: 162,854,975 (GRCm39) D362G probably benign Het
Sim1 T C 10: 50,859,796 (GRCm39) Y553H probably damaging Het
Sipa1l2 T C 8: 126,208,896 (GRCm39) D504G probably damaging Het
Smad7 T C 18: 75,502,547 (GRCm39) V174A possibly damaging Het
Smarcc1 T A 9: 109,996,792 (GRCm39) N303K possibly damaging Het
Snai3 T C 8: 123,183,038 (GRCm39) H169R possibly damaging Het
Tecpr2 T A 12: 110,895,505 (GRCm39) S331T possibly damaging Het
Tenm2 G A 11: 35,959,303 (GRCm39) T1082I probably benign Het
Tle4 A T 19: 14,429,890 (GRCm39) I627N probably damaging Het
Tnxb A T 17: 34,898,088 (GRCm39) N912I possibly damaging Het
Ube2q2l A G 6: 136,377,978 (GRCm39) V284A probably damaging Het
Vmn1r238 A T 18: 3,122,994 (GRCm39) V140E probably damaging Het
Vmn1r65 G A 7: 6,011,988 (GRCm39) T82I probably benign Het
Vps13b A G 15: 35,572,290 (GRCm39) K969R probably damaging Het
Zfp943 A G 17: 22,209,832 (GRCm39) R35G possibly damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTCCTGCAGCAATTTGGGC -3'
(R):5'- GTCATTGGTGATTGCAGAGATC -3'

Sequencing Primer
(F):5'- CAGCAATTTGGGCATTGTGACAG -3'
(R):5'- GTATGTCCAAGGATCTATGTC -3'
Posted On 2022-08-29