Incidental Mutation 'R8960:Myo7b'
ID 723569
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8960 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 31959234-32036961 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 31994246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000134663
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,983 E3548G probably damaging Het
Abcg4 G A 9: 44,274,766 Q603* probably null Het
Adar A G 3: 89,740,209 Y165C probably damaging Het
Afp A G 5: 90,503,641 T372A probably benign Het
Asah1 T A 8: 41,347,024 L184F probably damaging Het
Bpifb2 A T 2: 153,889,126 I206F possibly damaging Het
Btn1a1 C A 13: 23,464,571 D31Y possibly damaging Het
C4b T A 17: 34,733,918 D1110V probably damaging Het
Ccdc162 T A 10: 41,553,182 D1901V probably damaging Het
Cd101 A G 3: 101,003,501 V947A probably benign Het
Cd55b A T 1: 130,410,638 S238T possibly damaging Het
Cdc25c T C 18: 34,733,276 I437V possibly damaging Het
Cfap97 T C 8: 46,170,568 S332P probably damaging Het
Chpf A G 1: 75,475,754 L352P probably damaging Het
Cntln T A 4: 85,100,724 M1217K possibly damaging Het
Cntrl A G 2: 35,162,041 E1629G possibly damaging Het
Csnk1g2 T C 10: 80,638,562 Y206H probably damaging Het
Cyp2c55 T A 19: 39,007,103 W20R probably null Het
Dhx35 A T 2: 158,815,473 H130L possibly damaging Het
Dnm1 A G 2: 32,312,729 V54A probably damaging Het
Eea1 T A 10: 96,028,519 S967T probably benign Het
Elf3 A T 1: 135,255,075 I304N probably damaging Het
Eps8l1 G T 7: 4,478,215 R672L probably damaging Het
Fam129a A T 1: 151,715,712 H535L possibly damaging Het
Fam163a A T 1: 156,079,116 C96* probably null Het
Fam198b T C 3: 79,886,986 S254P probably benign Het
Fancd2 T C 6: 113,563,168 probably null Het
Fbxo3 C T 2: 104,027,929 L23F possibly damaging Het
Fbxw14 A G 9: 109,285,299 V121A possibly damaging Het
Fgd6 T A 10: 94,045,006 V574D probably benign Het
Gbp11 A G 5: 105,331,385 F124S probably damaging Het
Gm11639 A G 11: 104,929,946 probably benign Het
Grin1 A T 2: 25,305,416 probably benign Het
Grm2 T G 9: 106,654,146 E48A probably benign Het
H2-M10.5 T A 17: 36,773,878 Y165N probably benign Het
Hoxa13 A C 6: 52,259,996 S172A probably benign Het
Ifih1 T A 2: 62,611,891 K376N possibly damaging Het
Insrr C A 3: 87,813,079 T1008K probably damaging Het
Itih1 A G 14: 30,933,457 S594P probably damaging Het
Kidins220 T C 12: 25,056,915 S1365P probably benign Het
Malrd1 A T 2: 15,565,430 K158* probably null Het
Man2c1 G A 9: 57,137,995 G504R probably damaging Het
Mbd1 T C 18: 74,273,819 probably null Het
Micall2 G A 5: 139,716,270 A323V probably benign Het
Mroh9 A C 1: 163,055,627 F428V probably benign Het
Obscn A T 11: 59,031,612 V6567E probably damaging Het
Olfr117 T A 17: 37,659,869 T155S probably benign Het
Olfr1389 A T 11: 49,430,716 Q80L probably benign Het
Olfr193 T A 16: 59,110,192 R139S probably benign Het
Olfr388-ps1 A C 11: 73,724,404 S207A unknown Het
Olfr393 A T 11: 73,847,341 C261* probably null Het
Olfr920 A T 9: 38,756,089 I134F possibly damaging Het
Pde4dip T C 3: 97,793,148 D238G probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pgbd5 T A 8: 124,384,436 Y172F probably benign Het
Pkd1 A G 17: 24,576,202 T2288A probably damaging Het
Ppp6r2 T A 15: 89,253,036 M1K probably null Het
Rc3h1 A G 1: 160,946,594 T344A probably damaging Het
Rgs5 T C 1: 169,676,892 V37A possibly damaging Het
Rgs9 A G 11: 109,248,989 S17P possibly damaging Het
Rusc1 T A 3: 89,084,558 D407V probably damaging Het
Rwdd1 T A 10: 34,019,387 I18F possibly damaging Het
Satb2 C T 1: 56,871,311 probably null Het
Sds A G 5: 120,483,594 E267G probably damaging Het
Sema4b T A 7: 80,225,328 V822E probably damaging Het
Sfxn5 A T 6: 85,289,194 M107K probably damaging Het
Slc5a8 C T 10: 88,886,173 probably benign Het
Sorbs1 T C 19: 40,398,604 D6G probably damaging Het
Syt14 A C 1: 192,984,207 probably benign Het
Vmn2r124 T G 17: 18,063,029 Y328* probably null Het
Vmn2r86 T A 10: 130,453,803 E74D probably benign Het
Vmo1 A C 11: 70,513,650 L175W probably damaging Het
Vps13a G T 19: 16,705,883 L982I possibly damaging Het
Wdr19 T C 5: 65,240,868 V812A probably benign Het
Wdr27 T C 17: 14,883,646 I733V probably benign Het
Wdr54 A T 6: 83,155,757 H38Q probably damaging Het
Wdr76 G A 2: 121,510,623 V50I probably damaging Het
Zfp930 T A 8: 69,227,889 N59K probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
R8984:Myo7b UTSW 18 31966349 missense probably null 0.68
R9356:Myo7b UTSW 18 31977043 missense probably damaging 1.00
R9357:Myo7b UTSW 18 31960076 missense probably damaging 1.00
R9364:Myo7b UTSW 18 32000360 missense probably benign 0.12
R9405:Myo7b UTSW 18 31976303 missense probably benign 0.00
R9533:Myo7b UTSW 18 31975244 missense probably benign 0.27
R9776:Myo7b UTSW 18 32000015 missense probably benign 0.45
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCCTGTGAGTGTGCAG -3'
(R):5'- ACAGATCCCCAGCCCTTATG -3'

Sequencing Primer
(F):5'- GTCACTGAGCTGCCACCAATTC -3'
(R):5'- AGCCCTTATGCCCCCTTG -3'
Posted On 2022-08-29