Incidental Mutation 'R8960:Myo7b'
ID 723569
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8960 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 32127299 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000134663
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 G A 9: 44,186,063 (GRCm39) Q603* probably null Het
Adar A G 3: 89,647,516 (GRCm39) Y165C probably damaging Het
Afp A G 5: 90,651,500 (GRCm39) T372A probably benign Het
Asah1 T A 8: 41,800,061 (GRCm39) L184F probably damaging Het
Bltp1 A G 3: 37,067,132 (GRCm39) E3548G probably damaging Het
Bpifb2 A T 2: 153,731,046 (GRCm39) I206F possibly damaging Het
Btn1a1 C A 13: 23,648,741 (GRCm39) D31Y possibly damaging Het
C4b T A 17: 34,952,892 (GRCm39) D1110V probably damaging Het
Ccdc162 T A 10: 41,429,178 (GRCm39) D1901V probably damaging Het
Cd101 A G 3: 100,910,817 (GRCm39) V947A probably benign Het
Cd55b A T 1: 130,338,375 (GRCm39) S238T possibly damaging Het
Cdc25c T C 18: 34,866,329 (GRCm39) I437V possibly damaging Het
Cfap97 T C 8: 46,623,605 (GRCm39) S332P probably damaging Het
Chpf A G 1: 75,452,398 (GRCm39) L352P probably damaging Het
Cntln T A 4: 85,018,961 (GRCm39) M1217K possibly damaging Het
Cntrl A G 2: 35,052,053 (GRCm39) E1629G possibly damaging Het
Csnk1g2 T C 10: 80,474,396 (GRCm39) Y206H probably damaging Het
Cyp2c55 T A 19: 38,995,547 (GRCm39) W20R probably null Het
Dhx35 A T 2: 158,657,393 (GRCm39) H130L possibly damaging Het
Dnm1 A G 2: 32,202,741 (GRCm39) V54A probably damaging Het
Eea1 T A 10: 95,864,381 (GRCm39) S967T probably benign Het
Efcab3 A G 11: 104,820,772 (GRCm39) probably benign Het
Elf3 A T 1: 135,182,813 (GRCm39) I304N probably damaging Het
Eps8l1 G T 7: 4,481,214 (GRCm39) R672L probably damaging Het
Fam163a A T 1: 155,954,862 (GRCm39) C96* probably null Het
Fancd2 T C 6: 113,540,129 (GRCm39) probably null Het
Fbxo3 C T 2: 103,858,274 (GRCm39) L23F possibly damaging Het
Fbxw14 A G 9: 109,114,367 (GRCm39) V121A possibly damaging Het
Fgd6 T A 10: 93,880,868 (GRCm39) V574D probably benign Het
Gask1b T C 3: 79,794,293 (GRCm39) S254P probably benign Het
Gbp11 A G 5: 105,479,251 (GRCm39) F124S probably damaging Het
Grin1 A T 2: 25,195,428 (GRCm39) probably benign Het
Grm2 T G 9: 106,531,345 (GRCm39) E48A probably benign Het
H2-M10.5 T A 17: 37,084,770 (GRCm39) Y165N probably benign Het
Hoxa13 A C 6: 52,236,976 (GRCm39) S172A probably benign Het
Ifih1 T A 2: 62,442,235 (GRCm39) K376N possibly damaging Het
Insrr C A 3: 87,720,386 (GRCm39) T1008K probably damaging Het
Itih1 A G 14: 30,655,414 (GRCm39) S594P probably damaging Het
Kidins220 T C 12: 25,106,914 (GRCm39) S1365P probably benign Het
Malrd1 A T 2: 15,570,241 (GRCm39) K158* probably null Het
Man2c1 G A 9: 57,045,279 (GRCm39) G504R probably damaging Het
Mbd1 T C 18: 74,406,890 (GRCm39) probably null Het
Micall2 G A 5: 139,702,025 (GRCm39) A323V probably benign Het
Mroh9 A C 1: 162,883,196 (GRCm39) F428V probably benign Het
Niban1 A T 1: 151,591,463 (GRCm39) H535L possibly damaging Het
Obscn A T 11: 58,922,438 (GRCm39) V6567E probably damaging Het
Or1e28-ps1 A C 11: 73,615,230 (GRCm39) S207A unknown Het
Or1e33 A T 11: 73,738,167 (GRCm39) C261* probably null Het
Or2g25 T A 17: 37,970,760 (GRCm39) T155S probably benign Het
Or2y1d A T 11: 49,321,543 (GRCm39) Q80L probably benign Het
Or5h25 T A 16: 58,930,555 (GRCm39) R139S probably benign Het
Or8b53 A T 9: 38,667,385 (GRCm39) I134F possibly damaging Het
Pde4dip T C 3: 97,700,464 (GRCm39) D238G probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Pgbd5 T A 8: 125,111,175 (GRCm39) Y172F probably benign Het
Pkd1 A G 17: 24,795,176 (GRCm39) T2288A probably damaging Het
Ppp6r2 T A 15: 89,137,239 (GRCm39) M1K probably null Het
Rc3h1 A G 1: 160,774,164 (GRCm39) T344A probably damaging Het
Rgs5 T C 1: 169,504,461 (GRCm39) V37A possibly damaging Het
Rgs9 A G 11: 109,139,815 (GRCm39) S17P possibly damaging Het
Rusc1 T A 3: 88,991,865 (GRCm39) D407V probably damaging Het
Rwdd1 T A 10: 33,895,383 (GRCm39) I18F possibly damaging Het
Satb2 C T 1: 56,910,470 (GRCm39) probably null Het
Sds A G 5: 120,621,659 (GRCm39) E267G probably damaging Het
Sema4b T A 7: 79,875,076 (GRCm39) V822E probably damaging Het
Sfxn5 A T 6: 85,266,176 (GRCm39) M107K probably damaging Het
Slc5a8 C T 10: 88,722,035 (GRCm39) probably benign Het
Sorbs1 T C 19: 40,387,048 (GRCm39) D6G probably damaging Het
Syt14 A C 1: 192,666,515 (GRCm39) probably benign Het
Vmn2r124 T G 17: 18,283,291 (GRCm39) Y328* probably null Het
Vmn2r86 T A 10: 130,289,672 (GRCm39) E74D probably benign Het
Vmo1 A C 11: 70,404,476 (GRCm39) L175W probably damaging Het
Vps13a G T 19: 16,683,247 (GRCm39) L982I possibly damaging Het
Wdr19 T C 5: 65,398,211 (GRCm39) V812A probably benign Het
Wdr27 T C 17: 15,103,908 (GRCm39) I733V probably benign Het
Wdr54 A T 6: 83,132,739 (GRCm39) H38Q probably damaging Het
Wdr76 G A 2: 121,341,104 (GRCm39) V50I probably damaging Het
Zfp930 T A 8: 69,680,541 (GRCm39) N59K probably damaging Het
Zfyve9 T C 4: 108,501,558 (GRCm39) N1218S possibly damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCCTGTGAGTGTGCAG -3'
(R):5'- ACAGATCCCCAGCCCTTATG -3'

Sequencing Primer
(F):5'- GTCACTGAGCTGCCACCAATTC -3'
(R):5'- AGCCCTTATGCCCCCTTG -3'
Posted On 2022-08-29