Incidental Mutation 'R9296:Rnf213'

• ID: 723581
• Institutional Source: Beutler Lab
• Gene Symbol: Rnf213
• Ensembl Gene: ENSMUSG00000070327
• Gene Name: ring finger protein 213
• Synonyms: D11Ertd759e
• Accession Numbers:

  Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R9296 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 119393100-119487418 bp(+) (GRCm38)
• Type of Mutation: splice site
• DNA Base Change (assembly): A to T at 119443795 bp (GRCm38)
• Zygosity: Heterozygous
• Ref Sequence: ENSEMBL: ENSMUSP00000115063
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
• AlphaFold: no structure available at present
• Predicted Effect: probably benign; Transcript: ENSMUST00000093902
• SMART Domains: Protein: ENSMUSP00000091429; Gene: ENSMUSG00000070327

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

• Predicted Effect: probably benign; Transcript: ENSMUST00000131035
• SMART Domains: Protein: ENSMUSP00000115063; Gene: ENSMUSG00000070327

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

• Meta Mutation Damage Score: 0.0846
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
• Validation Efficiency: 98% (56/57)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
• Allele List at MGI:

  All alleles(13) : Targeted, other(2) Gene trapped(11)

• Posted On: 2022-08-31

Predicted Primers

PCR Primer
(F):5'- CTGGATTGTGCAACACCAGAC -3'
(R):5'- TGTCCCTGGTCCTGCTAGAATG -3'

Sequencing Primer
(F):5'- AACACCAGACGCTGTGGTC -3'
(R):5'- GCTAGAATGCTGCCTTTCTAAG -3'