Incidental Mutation 'R9028:Itk'
ID 723603
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene Name IL2 inducible T cell kinase
Synonyms Tcsk, Tsk, Emt
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46215977-46280342 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 46235710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]
AlphaFold Q03526
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020664
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101306
SMART Domains Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109237
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46,258,723 (GRCm39) missense probably damaging 1.00
IGL01349:Itk APN 11 46,232,027 (GRCm39) missense possibly damaging 0.84
IGL03290:Itk APN 11 46,225,764 (GRCm39) missense probably damaging 1.00
IGL03385:Itk APN 11 46,222,688 (GRCm39) nonsense probably null
Calame UTSW 11 46,233,222 (GRCm39) splice site probably null
carbone UTSW 11 46,222,776 (GRCm39) nonsense probably null
demon UTSW 11 46,231,539 (GRCm39) missense probably damaging 1.00
goodnow UTSW 11 46,228,926 (GRCm39) splice site probably null
itxaro UTSW 11 46,229,044 (GRCm39) missense probably damaging 1.00
Segun UTSW 11 46,235,710 (GRCm39) intron probably benign
BB009:Itk UTSW 11 46,231,519 (GRCm39) missense probably benign
BB019:Itk UTSW 11 46,231,519 (GRCm39) missense probably benign
R0095:Itk UTSW 11 46,233,279 (GRCm39) missense probably damaging 0.99
R0265:Itk UTSW 11 46,280,285 (GRCm39) start gained probably benign
R0281:Itk UTSW 11 46,244,743 (GRCm39) missense probably damaging 1.00
R0463:Itk UTSW 11 46,222,816 (GRCm39) missense probably damaging 1.00
R0518:Itk UTSW 11 46,251,115 (GRCm39) missense probably damaging 0.98
R0521:Itk UTSW 11 46,251,115 (GRCm39) missense probably damaging 0.98
R1121:Itk UTSW 11 46,222,721 (GRCm39) missense possibly damaging 0.93
R1550:Itk UTSW 11 46,280,153 (GRCm39) missense probably damaging 1.00
R1762:Itk UTSW 11 46,227,309 (GRCm39) missense probably damaging 0.98
R2418:Itk UTSW 11 46,229,044 (GRCm39) missense probably damaging 1.00
R2419:Itk UTSW 11 46,229,044 (GRCm39) missense probably damaging 1.00
R2859:Itk UTSW 11 46,235,662 (GRCm39) intron probably benign
R3107:Itk UTSW 11 46,218,291 (GRCm39) missense probably benign 0.15
R3546:Itk UTSW 11 46,246,675 (GRCm39) missense probably benign 0.00
R4601:Itk UTSW 11 46,227,342 (GRCm39) missense probably benign 0.17
R4610:Itk UTSW 11 46,227,342 (GRCm39) missense probably benign 0.17
R4792:Itk UTSW 11 46,235,658 (GRCm39) intron probably benign
R4885:Itk UTSW 11 46,227,171 (GRCm39) splice site probably null
R4934:Itk UTSW 11 46,280,152 (GRCm39) missense probably damaging 1.00
R5286:Itk UTSW 11 46,228,926 (GRCm39) splice site probably null
R5328:Itk UTSW 11 46,222,703 (GRCm39) missense probably benign 0.04
R5399:Itk UTSW 11 46,228,938 (GRCm39) missense probably benign 0.44
R5958:Itk UTSW 11 46,235,682 (GRCm39) intron probably benign
R6235:Itk UTSW 11 46,227,255 (GRCm39) missense probably benign 0.16
R6828:Itk UTSW 11 46,232,045 (GRCm39) missense probably damaging 1.00
R6849:Itk UTSW 11 46,222,762 (GRCm39) missense probably damaging 1.00
R7356:Itk UTSW 11 46,258,659 (GRCm39) missense possibly damaging 0.72
R7753:Itk UTSW 11 46,222,722 (GRCm39) missense probably damaging 1.00
R7932:Itk UTSW 11 46,231,519 (GRCm39) missense probably benign
R7988:Itk UTSW 11 46,246,661 (GRCm39) missense probably damaging 0.99
R8188:Itk UTSW 11 46,222,776 (GRCm39) nonsense probably null
R8337:Itk UTSW 11 46,233,222 (GRCm39) splice site probably null
R8738:Itk UTSW 11 46,231,539 (GRCm39) missense probably damaging 1.00
R8993:Itk UTSW 11 46,225,735 (GRCm39) missense probably damaging 1.00
R9650:Itk UTSW 11 46,222,778 (GRCm39) missense probably damaging 1.00
U24488:Itk UTSW 11 46,228,971 (GRCm39) missense probably damaging 1.00
X0062:Itk UTSW 11 46,256,871 (GRCm39) missense probably benign 0.15
Z1088:Itk UTSW 11 46,244,689 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCACATCACTGATCC -3'
(R):5'- AGATTTCCCCTCTACAAAGTCAG -3'

Sequencing Primer
(F):5'- ACTGATCCACGTTCTGAAGG -3'
(R):5'- CTACAAAGTCAGCTTTTCTGTACAG -3'
Posted On 2022-09-08