Incidental Mutation 'R9028:Itk'
ID 723603
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene Name IL2 inducible T cell kinase
Synonyms Emt, Tsk, Tcsk
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46325150-46389515 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 46344883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]
AlphaFold Q03526
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020664
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101306
SMART Domains Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109237
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cox4i1 T A 8: 120,671,283 probably benign Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dock10 A T 1: 80,606,295 probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Zscan18 A T 7: 12,772,189 probably benign Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
demon UTSW 11 46340712 missense probably damaging 1.00
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
Segun UTSW 11 46344883 intron probably benign
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
R8993:Itk UTSW 11 46334908 missense probably damaging 1.00
R9650:Itk UTSW 11 46331951 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCACATCACTGATCC -3'
(R):5'- AGATTTCCCCTCTACAAAGTCAG -3'

Sequencing Primer
(F):5'- ACTGATCCACGTTCTGAAGG -3'
(R):5'- CTACAAAGTCAGCTTTTCTGTACAG -3'
Posted On 2022-09-08