Incidental Mutation 'R9073:Ticrr'
ID 723613
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R9073 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79667931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 404 (D404E)
Ref Sequence ENSEMBL: ENSMUSP00000146221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
AA Change: D404E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Clasp1 C A 1: 118,462,463 probably null Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Gm12887 G T 4: 121,622,041 probably null Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Hydin G A 8: 110,267,451 probably null Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Masp1 A C 16: 23,469,921 S710A probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nags T C 11: 102,147,521 L351P probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr1466 A G 19: 13,341,874 T39A possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Rad51b T G 12: 79,297,665 probably benign Het
Rgs12 A T 5: 35,020,409 probably benign Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Svil T C 18: 5,097,500 I1574T probably benign Het
Tinag T A 9: 76,997,018 probably null Het
Tpbg A T 9: 85,842,871 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
R9779:Ticrr UTSW 7 79679054 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TAAGAGGCTCAGTGGCACAG -3'
(R):5'- TGACCATCCTATTTGGCCAACTAC -3'

Sequencing Primer
(F):5'- AGTGGCACAGTGGTCTCTC -3'
(R):5'- TGGGATTTGAACTCCAGACC -3'
Posted On 2022-09-08