Mutagenetix > Incidental Mutation

Incidental Mutation 'R9600:Sardh'

723646

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R9600 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27230501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 423 (Q423R)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

probably benign
Transcript: ENSMUST00000102886
AA Change: Q423R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: Q423R

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,165,175	L296Q	possibly damaging	Het
4932438A13Rik	A	T	3: 37,041,416	K1103*	probably null	Het
5730455P16Rik	A	G	11: 80,370,371	V210A	probably damaging	Het
Abcc9	G	A	6: 142,590,376	A1544V	possibly damaging	Het
Akap6	A	G	12: 52,886,558	T278A	probably benign	Het
Arfgef1	T	A	1: 10,163,752	I1106F	probably benign	Het
Armc7	T	C	11: 115,476,212	L61S	probably damaging	Het
Atp1a3	G	A	7: 25,000,602	T111M	probably benign	Het
BC017158	T	A	7: 128,276,504	D253V	possibly damaging	Het
Cacna2d4	T	A	6: 119,345,062	S962R	probably benign	Het
Camsap2	T	C	1: 136,277,198	T526A		Het
Casq2	A	T	3: 102,145,306	D378V	unknown	Het
Chst8	C	T	7: 34,675,221	D398N	possibly damaging	Het
Cmya5	C	T	13: 93,090,096	G2828D	probably damaging	Het
Cntnap2	T	A	6: 45,992,075	N250K	probably damaging	Het
Cpne5	T	C	17: 29,161,546	N401D	probably damaging	Het
Cse1l	A	G	2: 166,915,199	N7S	probably damaging	Het
Cyp4f39	G	A	17: 32,486,946	G337D	probably damaging	Het
Dera	C	T	6: 137,837,137	R308C	probably benign	Het
Drd5	T	A	5: 38,320,831	I389N	possibly damaging	Het
F830016B08Rik	A	G	18: 60,300,165	T107A	probably damaging	Het
Fbxw22	C	A	9: 109,383,918	L320F	probably damaging	Het
Fndc3b	G	T	3: 27,498,792	T352K	probably damaging	Het
Gm36864	T	A	7: 44,236,851	I169K	unknown	Het
Gm6614	T	G	6: 142,003,508		probably null	Het
Hdac4	A	T	1: 91,961,555	D749E	probably damaging	Het
Herc1	C	T	9: 66,397,312	A805V	possibly damaging	Het
Hrh1	A	G	6: 114,480,492	K245E	probably benign	Het
Khdc1a	A	G	1: 21,350,980	T130A	probably benign	Het
Lrp5	C	G	19: 3,591,712	A1417P	probably benign	Het
Macf1	T	C	4: 123,471,209	Q3253R	possibly damaging	Het
Mdn1	T	A	4: 32,684,723	L811*	probably null	Het
Mettl8	T	C	2: 70,982,039	D84G	possibly damaging	Het
Miga1	T	G	3: 152,287,549	T412P	probably benign	Het
Mtor	G	T	4: 148,547,635	R2322L	possibly damaging	Het
Muc16	T	C	9: 18,655,851	N1791D	unknown	Het
Myo9b	C	G	8: 71,290,431	S45R	possibly damaging	Het
Olfm4	T	C	14: 80,006,307	F105S	probably damaging	Het
Olfr313	A	T	11: 58,817,544	I179F	possibly damaging	Het
Osbpl1a	T	C	18: 12,882,220	I384V	probably benign	Het
Pcnx	T	C	12: 81,983,661	L1131P		Het
Pex6	T	A	17: 46,724,396	V827E	probably damaging	Het
Plek	A	C	11: 16,990,119	S197A	probably benign	Het
Pmpca	T	C	2: 26,392,586	Y269H	probably benign	Het
Pop1	T	C	15: 34,512,735	I493T	probably benign	Het
Rap1gap2	T	C	11: 74,393,128	N615D	probably benign	Het
Rtp3	T	C	9: 110,986,130	Y389C	unknown	Het
Slc11a1	T	C	1: 74,383,529		probably null	Het
Slc5a4b	T	C	10: 76,060,405	D572G	probably damaging	Het
Slfn14	A	G	11: 83,279,222	V532A	probably benign	Het
Stxbp1	T	C	2: 32,811,108	Y264C	possibly damaging	Het
Syce1l	T	C	8: 113,655,118	I230T	unknown	Het
Taf5l	T	C	8: 124,003,434	Y172C		Het
Tex43	T	C	18: 56,592,378	W37R	probably benign	Het
Trpc4	A	T	3: 54,194,827	K49*	probably null	Het
Ttc13	A	G	8: 124,688,545	V285A	probably benign	Het
Ttc17	A	T	2: 94,374,545	L344Q	probably damaging	Het
Unc79	A	G	12: 103,169,713	H2469R	probably benign	Het
Xkr7	A	G	2: 153,054,473	I416V	probably benign	Het
Zeb2	C	A	2: 45,097,168	D35Y	unknown	Het
Zfp28	A	G	7: 6,394,918	H784R	probably benign	Het
Zfp644	A	C	5: 106,636,043	S848R	probably benign	Het
Zfp809	G	A	9: 22,239,088	E294K	possibly damaging	Het
Zfp820	A	G	17: 21,819,880	Y156H	probably benign	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCCACTTCCAAGAGATC -3'
(R):5'- CCCCATGGTATAGAGATTGGGG -3'

Sequencing Primer
(F):5'- ATCATCTGGGTCTCAAGGAAGGTTC -3'
(R):5'- ATAGAGATTGGGGGTGGGGC -3'

Posted On

2022-09-12