Mutagenetix > Incidental Mutation

Incidental Mutation 'R9600:Cse1l'

723652

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9600 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166915199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 7 (N7S)

Ref Sequence

ENSEMBL: ENSMUSP00000002790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000002790
AA Change: N7S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: N7S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168599
AA Change: N7S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: N7S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169290
AA Change: N7S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: N7S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,165,175	L296Q	possibly damaging	Het
4932438A13Rik	A	T	3: 37,041,416	K1103*	probably null	Het
5730455P16Rik	A	G	11: 80,370,371	V210A	probably damaging	Het
Abcc9	G	A	6: 142,590,376	A1544V	possibly damaging	Het
Akap6	A	G	12: 52,886,558	T278A	probably benign	Het
Arfgef1	T	A	1: 10,163,752	I1106F	probably benign	Het
Armc7	T	C	11: 115,476,212	L61S	probably damaging	Het
Atp1a3	G	A	7: 25,000,602	T111M	probably benign	Het
BC017158	T	A	7: 128,276,504	D253V	possibly damaging	Het
Cacna2d4	T	A	6: 119,345,062	S962R	probably benign	Het
Camsap2	T	C	1: 136,277,198	T526A		Het
Casq2	A	T	3: 102,145,306	D378V	unknown	Het
Chst8	C	T	7: 34,675,221	D398N	possibly damaging	Het
Cmya5	C	T	13: 93,090,096	G2828D	probably damaging	Het
Cntnap2	T	A	6: 45,992,075	N250K	probably damaging	Het
Cpne5	T	C	17: 29,161,546	N401D	probably damaging	Het
Cyp4f39	G	A	17: 32,486,946	G337D	probably damaging	Het
Dera	C	T	6: 137,837,137	R308C	probably benign	Het
Drd5	T	A	5: 38,320,831	I389N	possibly damaging	Het
F830016B08Rik	A	G	18: 60,300,165	T107A	probably damaging	Het
Fbxw22	C	A	9: 109,383,918	L320F	probably damaging	Het
Fndc3b	G	T	3: 27,498,792	T352K	probably damaging	Het
Gm36864	T	A	7: 44,236,851	I169K	unknown	Het
Gm6614	T	G	6: 142,003,508		probably null	Het
Hdac4	A	T	1: 91,961,555	D749E	probably damaging	Het
Herc1	C	T	9: 66,397,312	A805V	possibly damaging	Het
Hrh1	A	G	6: 114,480,492	K245E	probably benign	Het
Khdc1a	A	G	1: 21,350,980	T130A	probably benign	Het
Lrp5	C	G	19: 3,591,712	A1417P	probably benign	Het
Macf1	T	C	4: 123,471,209	Q3253R	possibly damaging	Het
Mdn1	T	A	4: 32,684,723	L811*	probably null	Het
Mettl8	T	C	2: 70,982,039	D84G	possibly damaging	Het
Miga1	T	G	3: 152,287,549	T412P	probably benign	Het
Mtor	G	T	4: 148,547,635	R2322L	possibly damaging	Het
Muc16	T	C	9: 18,655,851	N1791D	unknown	Het
Myo9b	C	G	8: 71,290,431	S45R	possibly damaging	Het
Olfm4	T	C	14: 80,006,307	F105S	probably damaging	Het
Olfr313	A	T	11: 58,817,544	I179F	possibly damaging	Het
Osbpl1a	T	C	18: 12,882,220	I384V	probably benign	Het
Pcnx	T	C	12: 81,983,661	L1131P		Het
Pex6	T	A	17: 46,724,396	V827E	probably damaging	Het
Plek	A	C	11: 16,990,119	S197A	probably benign	Het
Pmpca	T	C	2: 26,392,586	Y269H	probably benign	Het
Pop1	T	C	15: 34,512,735	I493T	probably benign	Het
Rap1gap2	T	C	11: 74,393,128	N615D	probably benign	Het
Rtp3	T	C	9: 110,986,130	Y389C	unknown	Het
Sardh	T	C	2: 27,230,501	Q423R	probably benign	Het
Slc11a1	T	C	1: 74,383,529		probably null	Het
Slc5a4b	T	C	10: 76,060,405	D572G	probably damaging	Het
Slfn14	A	G	11: 83,279,222	V532A	probably benign	Het
Stxbp1	T	C	2: 32,811,108	Y264C	possibly damaging	Het
Syce1l	T	C	8: 113,655,118	I230T	unknown	Het
Taf5l	T	C	8: 124,003,434	Y172C		Het
Tex43	T	C	18: 56,592,378	W37R	probably benign	Het
Trpc4	A	T	3: 54,194,827	K49*	probably null	Het
Ttc13	A	G	8: 124,688,545	V285A	probably benign	Het
Ttc17	A	T	2: 94,374,545	L344Q	probably damaging	Het
Unc79	A	G	12: 103,169,713	H2469R	probably benign	Het
Xkr7	A	G	2: 153,054,473	I416V	probably benign	Het
Zeb2	C	A	2: 45,097,168	D35Y	unknown	Het
Zfp28	A	G	7: 6,394,918	H784R	probably benign	Het
Zfp644	A	C	5: 106,636,043	S848R	probably benign	Het
Zfp809	G	A	9: 22,239,088	E294K	possibly damaging	Het
Zfp820	A	G	17: 21,819,880	Y156H	probably benign	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAACCCTGTCTAAAAGATCCTGTC -3'
(R):5'- GTTTCTGCTATGTGTCTCAAGAATC -3'

Sequencing Primer
(F):5'- TGGCACAAGTTCTAGGCCATC -3'
(R):5'- ATTTCGGAGTTCAAGGCCAGC -3'

Posted On

2022-09-12