Incidental Mutation 'R9600:Cntnap2'
ID 723663
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9600 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45992075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 250 (N250K)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: N250K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: N250K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,175 L296Q possibly damaging Het
4932438A13Rik A T 3: 37,041,416 K1103* probably null Het
5730455P16Rik A G 11: 80,370,371 V210A probably damaging Het
Abcc9 G A 6: 142,590,376 A1544V possibly damaging Het
Akap6 A G 12: 52,886,558 T278A probably benign Het
Arfgef1 T A 1: 10,163,752 I1106F probably benign Het
Armc7 T C 11: 115,476,212 L61S probably damaging Het
Atp1a3 G A 7: 25,000,602 T111M probably benign Het
BC017158 T A 7: 128,276,504 D253V possibly damaging Het
Cacna2d4 T A 6: 119,345,062 S962R probably benign Het
Camsap2 T C 1: 136,277,198 T526A Het
Casq2 A T 3: 102,145,306 D378V unknown Het
Chst8 C T 7: 34,675,221 D398N possibly damaging Het
Cmya5 C T 13: 93,090,096 G2828D probably damaging Het
Cpne5 T C 17: 29,161,546 N401D probably damaging Het
Cse1l A G 2: 166,915,199 N7S probably damaging Het
Cyp4f39 G A 17: 32,486,946 G337D probably damaging Het
Dera C T 6: 137,837,137 R308C probably benign Het
Drd5 T A 5: 38,320,831 I389N possibly damaging Het
F830016B08Rik A G 18: 60,300,165 T107A probably damaging Het
Fbxw22 C A 9: 109,383,918 L320F probably damaging Het
Fndc3b G T 3: 27,498,792 T352K probably damaging Het
Gm36864 T A 7: 44,236,851 I169K unknown Het
Gm6614 T G 6: 142,003,508 probably null Het
Hdac4 A T 1: 91,961,555 D749E probably damaging Het
Herc1 C T 9: 66,397,312 A805V possibly damaging Het
Hrh1 A G 6: 114,480,492 K245E probably benign Het
Khdc1a A G 1: 21,350,980 T130A probably benign Het
Lrp5 C G 19: 3,591,712 A1417P probably benign Het
Macf1 T C 4: 123,471,209 Q3253R possibly damaging Het
Mdn1 T A 4: 32,684,723 L811* probably null Het
Mettl8 T C 2: 70,982,039 D84G possibly damaging Het
Miga1 T G 3: 152,287,549 T412P probably benign Het
Mtor G T 4: 148,547,635 R2322L possibly damaging Het
Muc16 T C 9: 18,655,851 N1791D unknown Het
Myo9b C G 8: 71,290,431 S45R possibly damaging Het
Olfm4 T C 14: 80,006,307 F105S probably damaging Het
Olfr313 A T 11: 58,817,544 I179F possibly damaging Het
Osbpl1a T C 18: 12,882,220 I384V probably benign Het
Pcnx T C 12: 81,983,661 L1131P Het
Pex6 T A 17: 46,724,396 V827E probably damaging Het
Plek A C 11: 16,990,119 S197A probably benign Het
Pmpca T C 2: 26,392,586 Y269H probably benign Het
Pop1 T C 15: 34,512,735 I493T probably benign Het
Rap1gap2 T C 11: 74,393,128 N615D probably benign Het
Rtp3 T C 9: 110,986,130 Y389C unknown Het
Sardh T C 2: 27,230,501 Q423R probably benign Het
Slc11a1 T C 1: 74,383,529 probably null Het
Slc5a4b T C 10: 76,060,405 D572G probably damaging Het
Slfn14 A G 11: 83,279,222 V532A probably benign Het
Stxbp1 T C 2: 32,811,108 Y264C possibly damaging Het
Syce1l T C 8: 113,655,118 I230T unknown Het
Taf5l T C 8: 124,003,434 Y172C Het
Tex43 T C 18: 56,592,378 W37R probably benign Het
Trpc4 A T 3: 54,194,827 K49* probably null Het
Ttc13 A G 8: 124,688,545 V285A probably benign Het
Ttc17 A T 2: 94,374,545 L344Q probably damaging Het
Unc79 A G 12: 103,169,713 H2469R probably benign Het
Xkr7 A G 2: 153,054,473 I416V probably benign Het
Zeb2 C A 2: 45,097,168 D35Y unknown Het
Zfp28 A G 7: 6,394,918 H784R probably benign Het
Zfp644 A C 5: 106,636,043 S848R probably benign Het
Zfp809 G A 9: 22,239,088 E294K possibly damaging Het
Zfp820 A G 17: 21,819,880 Y156H probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTTTGATGGCCACGGTGTG -3'
(R):5'- CGATAGCAGCTTTTCTCTGTTAAGAAG -3'

Sequencing Primer
(F):5'- ATGGCCACGGTGTGTTACC -3'
(R):5'- ACATGTCTGCTGGTCATAAAGGTCAG -3'
Posted On 2022-09-12