Incidental Mutation 'R9602:Vmn2r88'
ID 723750
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r3, V2r13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock # R9602 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 51410819-51419527 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51413732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 168 (S168T)
Ref Sequence ENSEMBL: ENSMUSP00000125126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: S176T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: S176T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: S168T

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: S143T

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: S168T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,002,977 S125L possibly damaging Het
Abca3 T C 17: 24,398,404 V1025A probably benign Het
Adam5 T C 8: 24,813,386 K175R probably damaging Het
Arhgap39 A C 15: 76,726,754 S885R probably damaging Het
Arhgef12 A G 9: 42,984,380 Y951H probably damaging Het
Bbs1 G A 19: 4,891,055 L544F probably damaging Het
Bcar1 C T 8: 111,713,866 E499K probably benign Het
Brinp3 C T 1: 146,746,496 T212I probably damaging Het
Cdh20 A T 1: 104,941,098 I105F probably benign Het
Cenpp T C 13: 49,647,573 E123G probably damaging Het
Col14a1 C A 15: 55,487,949 D1557E unknown Het
Col6a3 A T 1: 90,803,775 N1585K probably benign Het
Cox6a1 G A 5: 115,348,875 P26S unknown Het
Epb41l1 G T 2: 156,525,148 D646Y probably damaging Het
Fbxw10 G T 11: 62,859,956 R455L possibly damaging Het
Fmnl2 T C 2: 53,123,575 probably null Het
Gata3 T A 2: 9,858,486 I406F possibly damaging Het
Gm14406 C T 2: 177,569,235 G417D probably damaging Het
Gpr31b C T 17: 13,051,884 G133S possibly damaging Het
Gtf2h1 T A 7: 46,806,795 D196E possibly damaging Het
Hcn2 A G 10: 79,726,294 I375V probably benign Het
Kctd20 T C 17: 28,961,468 M72T probably benign Het
Klhl2 A T 8: 64,752,662 F408L probably damaging Het
Mllt10 T C 2: 18,207,039 V921A probably damaging Het
Mn1 A T 5: 111,417,583 probably benign Het
Mov10 A T 3: 104,800,968 D488E probably benign Het
Muc5b G T 7: 141,863,474 D3386Y probably benign Het
Myo15b G A 11: 115,878,443 probably null Het
Nudt7 T C 8: 114,151,759 F176L probably damaging Het
Obscn A G 11: 59,090,559 Y1878H probably damaging Het
Olfr785 A T 10: 129,409,933 D189V probably damaging Het
Pabpn1l T A 8: 122,620,362 T250S probably benign Het
Prr11 C T 11: 87,097,172 D302N possibly damaging Het
Prx T A 7: 27,519,020 V1121D possibly damaging Het
Ptcd1 A G 5: 145,159,638 V215A probably benign Het
Rasa3 T C 8: 13,631,844 D35G probably benign Het
Rbm5 A G 9: 107,751,953 S348P probably benign Het
Rmdn2 G A 17: 79,668,011 G310R probably damaging Het
Rnf114 T A 2: 167,511,242 C144* probably null Het
Rreb1 T C 13: 37,930,501 I612T probably damaging Het
Sdk1 A T 5: 142,085,598 D1181V probably damaging Het
Secisbp2l A T 2: 125,767,436 M324K probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc22a6 G T 19: 8,621,196 E206* probably null Het
Smg5 T C 3: 88,342,907 C109R probably damaging Het
Socs7 A G 11: 97,377,011 T323A probably benign Het
Spen T C 4: 141,477,872 N1148S unknown Het
Tek C G 4: 94,827,731 I463M possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ugt2b34 T C 5: 86,906,304 D206G probably damaging Het
Upk3a C T 15: 85,021,263 P191L probably benign Het
Vmn2r101 T A 17: 19,611,518 L592* probably null Het
Vmn2r82 A G 10: 79,379,046 I288V probably benign Het
Wnt5a C A 14: 28,518,338 N148K probably benign Het
Yipf5 T C 18: 40,212,081 Y82C probably damaging Het
Zfp655 T A 5: 145,244,663 C444S probably benign Het
Zpr1 A G 9: 46,273,365 N57D probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51413167 missense
R9038:Vmn2r88 UTSW 14 51414033 missense
R9063:Vmn2r88 UTSW 14 51410872 start gained probably benign
R9311:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51418740 missense
R9483:Vmn2r88 UTSW 14 51411184 missense
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- GTTCTAGGAATTTCAGACTTGTCAG -3'
(R):5'- ACAGATCCCATGCCTTTGG -3'

Sequencing Primer
(F):5'- GGAATTTCAGACTTGTCAGGAATAG -3'
(R):5'- GGCTTTCTTCTCTTAAATCTGAGAG -3'
Posted On 2022-09-12